Isozymes of α-amylases from newly isolated Bacillus thuringiensis CKB19: Production from immobilized cells

Maity, Chiranjit; Samanta, Saptadip; Halder, Suman Kumar; Mohapatra, Pradeep Kumar Das; Pati, Biswamoy; Jana, Malabendu; Mondal, Keshab Chandra

doi:10.1007/s12257-010-0218-5

Cited by 19 publications

(10 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The optimum temperature and pH for the amylase activity were 55°C and pH 9, respectively. The enzyme also showed good activity over a broad range of temperatures (50-85°C) and pH values (3)(4)(5)(6)(7)(8)(9)(10). The activity of the amylase was Ca 2+ independent.…”

Section: Discussionmentioning

confidence: 96%

Characterization and Optimization of Amylase Production in WangLB, a High Amylase-Producing Strain of Bacillus

Wang

Jeyaseelan

Lei

et al. 2016

Appl Biochem Biotechnol

View full text Add to dashboard Cite

The costs of amylase represent ca. 24 % of the expenditures in the starch industry and an increase in amylase production and/or activity will greatly cut down on production costs. In the present study, we obtained a high amylase-producing strain of bacteria, WangLB, and identified it as a member of the Bacillus genus based on 16S rDNA analysis. The fermentation conditions for amylase production in the strain were optimized, and the maximum amylase activity we obtained was 26,670 ± 1390 U/mL, under the optimized conditions of 48-h incubation in liquid starch medium, 35 °C, pH 10, 1 % v/v inoculum concentration, 20 g/L starch concentration, and 0.1 % w/v peptone. The influences of 16 small organic inducers on amylase production were tested, and the results showed that 20 mmol/L alanine greatly enhanced amylase production to 290 % of the baseline level. We also conducted an amylase enzymology analysis. The molecular weight of the amylase was 55 kD, determined by SDS-PAGE. The optimum temperature and pH for the amylase were 55 °C and pH 9, respectively. The enzyme also showed high activity over a wide range of temperatures (50-85 °C) and pH values (3-10), and the activity of the amylase was Ca(2+) independent. The kinetic parameters K m and V max were 0.37 ± 0.02 mg/mL and 233 U/mg, respectively. Finally, the amylase was applied to the hydrolysis of five different brands of starch. It was found that the hydrolyzability of the substrate by amylase increased along with starch solubility.

show abstract

Section: Discussionmentioning

confidence: 96%

Characterization and Optimization of Amylase Production in WangLB, a High Amylase-Producing Strain of Bacillus

Wang

Jeyaseelan

Lei

et al. 2016

Appl Biochem Biotechnol

View full text Add to dashboard Cite

show abstract

“…Amplified PCR product was purified using Qiagen Mini elute gel extraction kit (Qiagen, Japan). Forward and reverse DNA sequencing reaction of PCR amplicon was carried out with 27 F AGAGTTTGATCCTGGCTCAG and 1492 R GGTTACCTTGTTACGACTT primers using BDTv3.1 Cycle sequencing kit on (ABI3730xl) Genetic Analyzer [25]. A single discrete PCR amplicon band of 1500bp was observed when resolved on 1.2% agarose gel.…”

Section: F Pcr Amplification Of 16s Rdna Genementioning

confidence: 99%

Prevalence, Screening and Characterization of Starch Degrading Bacteria from Sago Industry Wastes

Nagarajan¹

2018

IJRASET

View full text Add to dashboard Cite

The sago processing industries generate high concentrations of organic pollutants. These industries required about 20,000 to 40,000 litres of water per ton of sago processing. They let out the water with hightoxic and organic matter causing serious threats to the environment and aquatic life. Potential starch degrading microorganisms are required to degrade the organic contaminants in the sago industry wastes before being generated. Sago wastes were collected from sago industries using sterilecans and polythene bags. The bacterial strains were obtained by adopting serial dilution methods and they were identified up to the generic level by their morphology and biochemical characteristics. The potential strains were screened by starch hydrolysis test and they were identified to the species level by 16s rDNA sequencing. The aligned sequences were evolutionary genetics analysis format using MEGA v.2.1 software and construct phylogenetic trees using the neighbour-joining method and SDS-PAGE zymogram analysis starch degrading bacteria producing amylase enzyme.There are 103bacterial strains were isolated and identified. They were belonging to the genera of Bacillus (72%), Micrococcus (8%), Enterobacteriaceae (6%), Corneybacterium (5%), Aeromonas (4%), Alcalinges (3%) and Pesudomonas (2%). Among the isolates, there are 5 strains namely S5, S7, S16, S20 and S28 were selected as potential starch degraders. The database of the strains wassubmitted to the NCBI gen bank and got the accession numbers (S5-KY213660, KY213661, KY213662, KY230509 and KY230510).The molecular mass of the amylase was estimated to be ~45 kDa by SDS-PAGE and zymogram analysis. The strains S5, S7, S16, S20 and S28 showed more efficiency for the degradation of starch. These strains can be used to degrade starch from the waste substrates fabricating with amylase and glucose as the products.

show abstract

“…Amplified PCR product was purified using Qiagen Mini elute gel extraction kit (Qiagen, Japan). Forward and reverse DNA sequencing reaction of PCR amplicon was carried out with 27F AGAGTTTGATCMTGGCTCAG and 1492 R TACGGYTACCTTGTTACGACTT primers using BDTv3.1 Cycle sequencing kit on (ABI3730xl) Genetic Analyzer [13]. A single discrete PCR amplicon band of 1500 bp was observed when resolved on 1.2% agarose gel.…”

Section: Pcr Amplification Of 16s Rdna Genementioning

confidence: 99%

Digestion of Tannin by Bacteria Enterobacter cloacae from the Gut of Indian Mole Cricket (Gryllotalpa krishnani)

RK¹,

Revathi²,

Rameshkumar³

et al. 2017

J Bioprocess Biotech

View full text Add to dashboard Cite

Insects are the most successful animal on earth; the gut microbes present might play an important role in food digestion as well as the interaction with hosts. In this study insect Gryllotalpa krishnani has been used to isolate the symbiotic associated organisms which play role in host metabolism, promote efficient digestion and to protect the host from the harmful microbes. In the present study, microorganisms were isolated from the gut of G. krishnani and characterized for tannase enzyme activity. It was observed that 5 isolates (TAH 6, TAH 13, TAH 36, TAH 38 and TAH 41) out of total 120 tested were able to show significant growth on tannic acid plate. Among these five potential isolates, strain TAH 41 exhibited maximum tannase activity in tannase plate assay and was selected for the further study. The bacterial strain TAH41 was analyzed for biochemical analysis, 16S rDNA sequencing and the result confirmed the strain as Enterobacter cloacae. HPLC analysis showed the formation two peaks representing gallic acid and glucose as a by-product FT-IR analysis also confirmed the same. The polyacrylamide gel electrophoresis (SDS-PAGE) and zymogram analysis showed the molecular mass of tannase enzyme in cell free extract was ~45 kDa, the analysis suggested this tannase enzyme to be one of the smallest of the bacterial source, which could be attributed to the formation of di or tri-galloyl glucose. The present study was the first report E. cloacae with tannase activity from G. krishnani gut. E. cloacae which may endow the insect with some ecological advantages by enabling them to overcome the anti-nutritional effects of plant tannins.Citation: Rasiravuthanahalli KG, Revathi S, Rameshkumar N, Krishnan M, Kayalvizhi N (2017) Digestion of Tannin by Bacteria Enterobacter cloacae from the Gut of Indian Mole Cricket (Gryllotalpa krishnani).

show abstract

Isozymes of α-amylases from newly isolated Bacillus thuringiensis CKB19: Production from immobilized cells

Cited by 19 publications

References 24 publications

Characterization and Optimization of Amylase Production in WangLB, a High Amylase-Producing Strain of Bacillus

Characterization and Optimization of Amylase Production in WangLB, a High Amylase-Producing Strain of Bacillus

Prevalence, Screening and Characterization of Starch Degrading Bacteria from Sago Industry Wastes

Digestion of Tannin by Bacteria Enterobacter cloacae from the Gut of Indian Mole Cricket (Gryllotalpa krishnani)

Contact Info

Product

Resources

About