LidNA, a novel miRNA inhibitor constructed with unmodified DNA

Abstract

Edited by Tamas DalmayKeywords: miRNA inhibitor miRNA RNAi SPR Unmodified DNA RISC a b s t r a c t Many miRNA inhibitors have been developed and they are chemically modified oligonucleotides such as 2 0 -O-methylated RNA and locked nucleic acid (LNA). Unmodified DNA was not yet reported as a miRNA inhibitor because of the low affinity of DNA/miRNA compared to mRNA/miRNA. We designed a structured unmodified DNA that significantly inhibits miRNA function. The clue structure for activity is the miRNA binding site between double stranded regions which is responsible for the miRNA inhibitory activity and tight binding to miRNA. We developed the miRNA inhibitor constructed with unmodified DNA, and named it LidNA, DNA that puts a lid on miRNA function.

Potential Diagnostic, Prognostic and Therapeutic Targets of MicroRNAs in Human Gastric Cancer

“…The methods of current miRNA-mediated treatment are focused on miRNA knockout or silencing the endogenous oncomiRs, including anti-miRNA oligonucleotides (AMOs) [ 13 ], miRNA sponges [ 235 ], miR-Mask [ 236 ], antagomiRs and miRNA inhibitors [ 12 , 237 ]. For example, Chun et al [ 200 ] transfected AS-miR-221/222 with liposomes into GC cell line SGC7901 to inhibit GC cell growth and invasion.…”

“…Their dysregulation has been reported to be involved in pathogenic processes underlying GC tumorigenesis and progression, including cell growth, invasion, metastasis, and apoptosis. Moreover, miRNAs are stable and persistent among individuals of the same species, even for several years in formalin-fixed, paraffin-embedded tissues and body fluids, such as plasma/serum, urine, saliva, and milk [ 11 , 12 , 13 , 14 , 15 ]. Therefore, aberrantly expressed miRNAs are potentially useful biomarkers for GC screening, diagnosis, prognosis and disease monitoring, as well as therapeutic targets.…”

LidNA, a miRNA inhibitor constructed with unmodified DNA, requires an xxxA insertion sequence in miRNA binding site for its potent inhibitory activity

“…The inhibitory activity of LidNA was measured by a reporter gene assay using a pDsRed2‐miR16 target containing three miR‐16 target sequences, 5′‐cgccaatatttacgtgctgctacgccaatatttacgtgctgctacgccaatatttacgtgctgcta‐3′ at the 3′‐UTR of the Dsred2 gene, using pCAGGS‐GFP as a control 22. HEK293T cells were seeded into a 24‐well plate (60 000 cells/well).…”

“…We reported the first effective unmodified DNA‐based miRNA inhibitor, LidNA, DNA that puts a lid on miRNA function, and demonstrated that the miRNA binding region between two double‐stranded regions bound with high affinity to the target miRNA 22. The double‐stranded regions repressed nucleotide movement in the miRNA binding region 23, thereby increasing the association rate constant, k a , of miRNA to the miRNA binding region by about 500‐fold compared with single‐stranded DNA, and 100‐fold compared with LNA and 2′‐ O ‐methylated RNA 22. In further investigations, we unexpectedly found that some variants of LidNA had low or no activity.…”

MiRNA inhibition in tissue engineering and regenerative medicine

“…LiDNA are thought to bind miRNA with higher affinity than typical single stranded DNA AMOs by reducing the free motion of the middle miRNA binding region [45]. When delivered in vitro using a cationic liposomal transfection reagent, LiDNA targeting miR-16 showed inhibitory activity at doses as low as 10 nM, and the inhibition effect of LidNA-16 was sustained for five days [46]. However, to our knowledge, there have not yet been any direct comparisons made between the miRNA binding affinity and nuclease stability of LiDNA and the other AMOs discussed in this section.…”