Light‐dependent regulation of carotenoid biosynthesis occurs at the level of phytoene synthase expression and is mediated by phytochrome in Sinapis alba and Arabidopsis thaliana seedlings

Abstract

In chloroplasts, carotenoids are essential pigments involved in photosynthesis. During-photomorphogenesis, a coordinated increase in the amounts of chlorophylls and carotenoids, in conjugation with other components, leads to the formation of a functional photosynthetic apparatus. To investigate the regulation of carotenoid biosynthesis during this process at the molecular level, GGPS, PSY and PDS cDNAs have been cloned from white mustard (Sinapis alba L). GGPS encodes a key enzyme in plastid isoprenoid metabolism, while the products of PSY and PDS catalyse the subsequent steps in carotenoid biosynthesis. Due to the low mRNA levels of the genes involved, the use of a RT-PCR protocol was necessary to measure gene expression during photomorphogenesis. With light, there is an up-regulation of PSY expression, the first gene within the carotenoid biosynthetic pathway, while PDS and GGPS expression levels remain constant. Treatment with different light qualities reveals a phytochrome-mediated regulation of PSY expression in developing white mustard seedlings. To obtain more detailed information on the light-regulation, Arabidopsis thaliana wild-type and phytochrome mutants were utilized. Continuous far-red and red light both increase the expression of PSY in wild-type seedlings, demonstrating that both light-labile and light-stable phytochromes are involved in PSY regulation. The response to far-red light is completely abolished in the phyA mutant, showing that PHYA mediates the increase in PSY transcript levels under these light conditions. In the phyB mutant, the red light response is normal, indicating that PSY expression is not controlled by PHYB but by other light-stable phytochromes. Measurement of chlorophylls and carotenoids under the same light regimes shows that the up-regulation of PSY expression does not necessarily result in an increase of the carotenoid content. Only those light conditions which allow chlorophyll biosynthesis lead to a significant increase of the carotenoid content. Therefore, it is proposed that up-regulation of PSY mRNA levels leads to an increased capacity for the formation of carotenoids. However, this only takes place under light conditions leading to protochlorophyllide photoconversion.

Circadian Rhythms of Isoprene Biosynthesis in Grey Poplar Leaves

“…PSY is the first dedicated and regulating enzyme of the carotenoid pathway (Von Lintig et al, 1997). Carotenoid functions are really diverse, ranging from primary metabolites involved in photosynthesis to secondary ones stored in chromoplasts (attracting pollinators and seed dispersers) or to vitamin and hormone precursors.…”

Carotenoids and Photosynthesis - Regulation of Carotenoid Biosyntesis by Photoreceptors

“…PHYA, PHYB and CRY1, can also activate the Z-box (ATCTATTCGTATACGTGTCAC), another LRE present in light inducible promoters (Yadav et al, 2002). In A.thaliana, it has been shown that PHYA, but not PHYB, plays a role in the transcriptional induction of psy by promoting the binding of HY5 to white, blue, red and far red light responsive elements (LREs) located in its promoter (von Lintig et al, 1997). The involvement of the b-zip transcription factor HY5 in tomato carotenogenesis was proven with LeHY5 transgenic tomatoes that carry an antisense sequence or RNAi of the HY5 transcription factor gene.…”

“…Carotenoids are required during photosynthesis in plants and algae and therefore, genes that direct the biosynthesis of carotenoids in these organisms are also regulated by light (von Lintig et al, 1997;Welsch et al, 2000;Simkin et al, 2003;Woitsch & Römer, 2003, Ohmiya et al, 2006Briggs et al, 2007). The process of de-etiolation of leaves has been used to compare the levels of carotenoids and gene expression in dark-grown plants versus plants that were transferred to light after being in darkness.…”

“…The process of de-etiolation of leaves has been used to compare the levels of carotenoids and gene expression in dark-grown plants versus plants that were transferred to light after being in darkness. During de-etiolation of A. thaliana, the expression of ggpps and pds genes are relatively constant, whereas expression of the single copy gene, psy and hdr are significantly enhanced (von Lintig et al, 1997;Welsch et al, 2000, Botella-Pavía et al, 2004. Evidence indicates that the transcriptional activation of psy, dxs and dxr is essential for the induction of carotenoid biosynthesis in green organs (Welsch et al, 2003;Toledo-Ortiz et al, 2010).…”

Establishing an Efficient Fruit Ripening Method for Sweet Pepper (<i>Capsicum anuum</i> L.) through Light Irradiation and Dark Processing

“…This increase in the expression level of PSY may be due to light-stress. In contrast, earlier studies have demonstrated that the gene expression of PSY is controlled by the phytochrome in sinapis alba and arabidopsis (Von Lintig et al, 1997). The mechanism for light-driven carotenoid synthesis in sweet pepper fruit is still somewhat unclear and further research is required to better address this topic.…”