miR-382-5p modulates the ATRA-induced differentiation of acute promyelocytic leukemia by targeting tumor suppressor PTEN

Liu, Dongdong; Liu, Zhong; Yuan, Zhen; Yao, Juanjuan; Zhong, Pengqiang; Liu, Junmei; Yao, Shifei; Zhao, Yi; Liu, Lu; Chen, Min; Li, Lianwen; Liu, Beizhong

doi:10.1016/j.cellsig.2018.11.012

Cited by 32 publications

(18 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The reciprocal relationship between miR-382 and PTEN has been reported in acute promyelocytic leukemia, infantile hemangioma, and liver regeneration 27 , 29 , 44 In our study, we performed a dual-luciferase reporter assay, which confirmed that miR-382 negatively regulated PTEN by combining the 3′UTR of gene pten in 293T cells. Further, immunohistochemical staining of PTEN and RT-qPCR of miR-382 in renal biopsy sections from patients with IgA nephropathy (with or without TIF) as well as protein expression of PTEN and its downstream AKT in kidney from mouse AAN model both in WT and miR-382 KO mice also substantiated this relationship.…”

Section: Discussionsupporting

confidence: 76%

“…In addition, depletion of PTEN was characteristic of renal fibrosis and overexpression of PTEN expression attenuated tubulointerstitial fibrosis [18][19][20][21][22] , inhibited macrophage polarization from M1 to M2 23,24 and suppressed inflammation responses 25,26 . Given that PTEN has been identified as a target of miR-382 in liver generation, acute promyelocytic leukemia, and tumor angiogenesis as well as oxidative stress of the tubular epithelium [27][28][29][30] , which remains unclear in kidney fibrosis. NF-κB is an important transcription factor that mediates the expression of various miRNAs [31][32][33][34] and is also a pivotal mediator of inflammation 35 .…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Upregulation of miR-382 contributes to renal fibrosis secondary to aristolochic acid-induced kidney injury via PTEN signaling pathway

et al. 2020

View full text Add to dashboard Cite

Acute kidney injury (AKI) has a critical role in the development of chronic kidney disease (CKD). Building on our previous findings, we explored the role of miR-382 in facilitating the transition of AKI to CKD using the Aristolochic acid (AA) nephropathy model, which was induced by intraperitoneal injection of aristolochic acid I salt (10 or 20 mg/kg). The effects of genetic depletion, pharmacologic inhibition, or overexpression of miR-382 on the PTEN/AKT signaling pathway were examined in vivo and in vitro. Changes in renal pathology and renal epithelial polarity were evaluated. A luciferase reporter assay was performed to investigate the reciprocal suppression relationship between miR-382 and PTEN. Renal fibrosis developed 14 d after AA exposure in a dose-and time-dependent manner. Renal abundance of miR-382 was upregulated following AA treatment, while genetic depletion or pharmacological inhibition of miR-382 partially reversed renal tubulointerstitial fibrosis. Expression of PTEN, a target of miR-382, was downregulated and subsequently its downstream AKT signaling pathway was activated during AKI to CKD transition induced by AA. Inhibition of PTEN in vitro resulted in the acquisition of the EMT phenotypes. Furthermore, upregulation of miR-382 in renal epithelial cells was partially mediated by the activation of NF-kB signaling, with a substantial elevation of proinflammatory cytokines. An in vivo study revealed that either miR-382 knockdown or miR-382 knockout was pivotal for inflammatory suppression, while an in vitro experiment confirmed that upregulation of miR-382 in cultured MTEC cells under AA exposure was remarkably reversed by NF-kB siRNA. These data indicated a novel role for the NF-κB/miR-382/PTEN/AKT axis in the pathogenesis of tubulointerstitial fibrosis following AA-induced acute renal tubular epithelial injury. Targeting miR-382 may lead to a potential novel therapeutic approach for retarding the AKT to CKD transition.

show abstract

Section: Discussionsupporting

confidence: 76%

Section: Introductionmentioning

confidence: 99%

Upregulation of miR-382 contributes to renal fibrosis secondary to aristolochic acid-induced kidney injury via PTEN signaling pathway

et al. 2020

View full text Add to dashboard Cite

show abstract

“…The mature gene locus were chr14:101,054,316-101,054,337, and the base sequence was GAAGUUGUUCGUGGUGGAUUCG , with a length of 22 nt. (Fig.1) 2.1.2 hsa-miR-382-5P participates in disease regulation Using PubMed to retrieve the related literature of miR-382-5P, we found that miR-382-5P was upregulated in acute promyelocytic leukemia [7,8] , atherosclerosis [12] ,breast cancer [4] ,epidural fibrosis [10] , primary myelofibrosis [9] , primary liver cancer [11] ,cervical cancer [13] , but down-regulated in glioma [5,6] ,oral squamous cell carcinoma [3] ,miR-382 was down-regulated in non-small cell lung cancer [14,15] , osteosarcoma [16] , prostate cancer [19] ,ovarian cancer [20] , primary liver cancer [24] , colorectal cancer [21,22] , while schizophrenia [25] ,diabetic nephropathy [17] , IgA nephropathy [18] ,infantile hemangioma [23] . Thus, the expression of miR-382-5P is tissue-specific, and it is involved in the regulation of cell viability, migration, invasion, angiogenesis, proliferation, cell differentiation, oxidative stress and other biological behaviors.…”

Section: Data Analysis Of Tcga Databasementioning

confidence: 99%

“…Related diseases Expression level Target gene Biological process miR-382-5P glioma ↓ ZIC4 [5] ,YBX1 [6] Cell viability, migration, angiogenesis, EMT, proliferation and invasion miR-382-5P acute promyelocytic leukemia ↑ PTEM [7] ,MXD 1 [8] hematopoietic stem cell differentiation miR-382-5P primary myelofibrosis ↑ SOD2 [9] DNA oxidative stress and inflammation miR-382-5P epidural fibrosis ↑ CollagenIA1 [10] epidural fibrosis miR-382-5P primary liver cancer ↑ DLC1 [11] migration miR-382-5P Breast cancer ↑ RERG [4] cell viability, colony-formation, migration, invasion, proliferation miR-382-5P atherosclerosis ↑ NFIA [12] cholesterol homeostasis,inflammatory reaction miR-382 non-small cell lung cancer ↓ LMO3 [14] , SETD8 [15] proliferation, metastasis, invasion miR-382 osteosarcoma ↓ KLF12,HIPK3 [16] growth,drug resistance, prognosis miR-382 schizophrenia ↑ FGFR1,SPRY [25] abnormal brain development and function miR-382 diabetic nephropathy ↑ FoxO1 [17] glomerular mesangial cell proliferation, extracelluar matrix accumulation miR-382…”

Section: Ethics Approvalmentioning

confidence: 99%

“…A series of nucleases obtained mature miR-382-5P and miR-382-3P by cutting and editing miR-382, in which miR-382-5P was located in the long arm of chromosome 14. In recent years, many studies have shown that the expression of miR-382-5P is abnormal in oral squamous cell carcinoma [3] ,breast cancer [4] ,glioma [5,6] ,acute promyelocytic leukemia [7,8] ,primary myelofibrosis [9] ,epidural fibrosis [10] ,primary liver cancer [11] ,atherosclerosis [12] ,cervical cancer [13] ,miR-382 is abnormal in non-small cell lung cancer [14,15] , osteosarcoma [16] , diabetic nephropathy [17] , IgA nephropathy [18] prostate cancer [19] ,ovarian cacner [20] ,colorectal cancer [21,22] ,infantile hemangioma [23] ,primary liver cancer [24] ,schizophrenia [25] , which are closely related to the proliferation, differentiation, migration, invasion, drug resistance and other biological processes of tumor cells. However, the expression and clinical significance of miR-382-5P in ovarian cancer have not been reported.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Analysis of the expression and clinical significance of miR-382-5P in ovarian cancer based on biological information

2020

Preprint

View full text Add to dashboard Cite

Objective : To investigate the expression, potential function and clinical significance of miR-382-5P in ovarian cancer tissues . Results: The expression of miR-382-5P is tissue-specific. Four target gene prediction softwares including miRPathDB ,DIANA ,miRWalk and starBase simultaneously predicted 24 target genes (AHRR，ANKS1A，C15orf41，CABYR，CASP3，COBLL1，EEF2K，FBXO28，FGFR1OP，LRP12，MDM4，PAIP2，PARM1，PDE5A，PIAS2，SAR1B，SCD，SLC44A1，TIMM17A，TSPYL1，UBXN7， YES1，ZBTB37，ZNF587). Significant enrichment of target gene function in biological processes, cell composition and molecular functions, signal transduction pathways are significantly enriched in microRNAs in cancer , MAPK signaling pathway, Hepatitis B, FoxO signaling pathway, Non-small cell lung cancer, apoptosis, Colorectal cancer, Oxytocin signaling pathway. TCGA database data analysis did not indicate that there was a correlation between the expression of miR-382-5P and the clinicopathological parameters of ovarian cancer, but there was no significant difference (P>0.05). The results of QRT-PCR in 72 ovarian cancer clinical specimens showed that the expression of miR-382-5P was significantly increased in drug-resistant tissues (4.60±2.959) and significantly decreased in sensitive tissues (1.88±2.082). The difference was statistically significant (P<0.05). Analyzing the follow-up data of 72 patients with ovarian cancer in our hospital, we found that the expression level of miR-382-5P in ovarian cancer patients was correlated with the degree of drug resistance, and the difference was statistically significant (P<0.05). The expression level of miR-382-5P, drug resistance , recurrence and treatment response in patients with ovarian cancer were correlated with their overall survival (OS), and the difference was statistically significant (P<0.05). The expression level of miR-382-5P, drug resistance, treatment response, recurrence and residual lesion size in patients with ovarian cancer were correlated with their progression-free survival (PFS), the difference was statistically significant (P<0.05). Multidrug resistance is an independent risk factor affecting the prognosis of ovarian cancer, the difference was statistically significant (P<0.05) Conclusion ： After comprehensive analysis, it is found that miR-382-5P may become a new target for the treatment of multidrug resistant ovarian cancer. The signal pathways of MAPK, Fox-1,apoptosis and so on may be the main mechanism of miR-382-5P mediating the occurrence and development of ovarian cancer, and lay a certain foundation for the research of targeted miR-382-5P in the treatment of multidrug resistant ovarian cancer.

show abstract

The regulation of PTEN: Novel insights into functions as cancer biomarkers and therapeutic targets

Xiao

Pan

Liu

et al. 2023

Journal Cellular Physiology

View full text Add to dashboard Cite

This review summarizes the implications of the primary tumor suppressor protein phosphatase and tensin homolog (PTEN) in aggressive cancer development. PTEN interacts with other cellular proteins or factors suggesting the existence of an intricate molecular network that regulates their oncogenic function. Accumulating evidence has shown that PTEN exists and plays a role in the cytoplasmic organelles and in the nucleus. PTEN blocks phosphoinositide 3‐kinases (PI3K)–protein kinase B–mammalian target of rapamycin signaling pathway by dephosphorylating phosphatidylinositol (PI)‐3,4,5‐triphosphate to PI‐4,5‐bisphosphate thus counteracting PI3K function. Studies have shown that PTEN expression is tightly regulated at transcriptional, posttranscriptional, and posttranslational levels (including protein–protein interactions and posttranslational modifications). Despite recent advances in PTEN research, the regulation and function of the PTEN gene remain largely unknown. How mutation or loss of specific exons in the PTEN gene occurs and involves in cancer development is not clear. This review illustrates the regulatory mechanisms of PTEN expression and discusses how PTEN participates in tumor development and/or suppression. Future prospects for the clinical applications are also highlighted.

show abstract

miR-382-5p modulates the ATRA-induced differentiation of acute promyelocytic leukemia by targeting tumor suppressor PTEN

Cited by 32 publications

References 39 publications

Upregulation of miR-382 contributes to renal fibrosis secondary to aristolochic acid-induced kidney injury via PTEN signaling pathway

Upregulation of miR-382 contributes to renal fibrosis secondary to aristolochic acid-induced kidney injury via PTEN signaling pathway

Analysis of the expression and clinical significance of miR-382-5P in ovarian cancer based on biological information

The regulation of PTEN: Novel insights into functions as cancer biomarkers and therapeutic targets

Contact Info

Product

Resources

About