Mitochondrial DNA methylation and copy number predict body composition in a young female population

Abstract

BackgroundSince both genomic and environmental factors are involved in obesity etiology, several studies about the influence of adiposity on both nuclear DNA and mitochondrial DNA methylation patterns have been carried out. Nevertheless, few evidences exploring the usage of buccal swab samples to study mitochondrial DNA epigenetics can be found in literature.MethodsIn this study, mitochondrial DNA from buccal swabs collected from a young Caucasian population (n = 69) have been used to examine potential correlation between mitochondrial DNA copy number and methylation with body composition (BMI, WHtR and bioimpedance measurements).ResultsA negative correlation between mitochondrial DNA copy number and BMI was measured in females (p = 0.028), but not in males. The mean percentage of D-loop methylation is significantly higher in overweight than in lean female subjects (p = 0.003), and a specific CpG located in the D-loop shows per se an association with impaired body composition (p = 0.004). Body composition impairment is predicted by a combined variable including mtDNA copy number and the D-loop methylation (AUC = 0.785; p = 0.009).ConclusionsThis study corroborates the hypothesis that mitochondrial DNA carries relevant information about body composition. However, wider investigations able to validate the usage of mtDNA methylation from buccal swabs as a biomarker are warranted.

Mitochondrial DNA and Neurodegeneration: Any Role for Dietary Antioxidants?

“…Indeed, EGCG-fed mice displayed higher body temperature and mtDNA content in BAT [244]. Of note, not only dietary antioxidants but other nutrients [245] or dietary regimen [246,247], as well as alteration of body composition [65], has shown association with mtDNA copy number, corroborating the hypothesis that diet and health status are strictly linked with the mtDNA function. Conversely, it has been recently demonstrated that alteration of mitochondrial DNA content can modulate antioxidant enzyme expressions and, consequentially, oxidative stress in the cell [248].…”

“…Since the efficiency and number of mitochondria can be manipulated by pharmacological and dietary treatments, it has been suggested that mitochondria may be a potential target for preventive medicine by tailoring personalized dietary approaches and supplementations [174]. Moreover, the emerging usage of mtDNA methylation and copy number as biomarkers [64,65,262,263] emphasizes the relevance of studies on mtDNA genomics and epigenomics, and reinforces the need for further investigations of this aspect, particularly with a focus on neurodegenerative disorders. Further research aimed to test the effects of dietary antioxidants on the mitochondrial genome are warranted.…”

“…While the correlation between nutrition, oxidative stress, and the nuclear epigenome is well described, to our knowledge, there are no molecular data on the effects of general antioxidants or mitochondria-targeted antioxidants on mtDNA epigenetics as yet. However, a certain responsiveness of the mitochondrial epigenome to external stimuli, including but not limited to dietary elements, has been postulated [65,67,120]. Remarkably, Corsi and colleagues recently demonstrated that mtDNA methylation can change accordingly to the adherence to the Mediterranean diet [250], corroborating the hypothesis of a potential role of nutrition in the modulation of mtDNA methylation.…”

Extra Virgin Olive Oil and Nigella sativa Oil Produced in Central Italy: A Comparison of the Nutrigenomic Effects of Two Mediterranean Oils in a Low-Grade Inflammation Model

“…MtDNA copy number was assessed as previously described [38] by a qPCR method using primers specific for mtDNA (mtpair21 fw-AATCCAAGCCTACGTTTTCACA; mtpair21 rv-AGTATGAGGAGCGTTATGGAGT) and normalizing for the amount of genomic DNA used in each reaction by using primers specific for gDNA (18s fw-GCAATTATTCCCCATGAACG; 18s-rv GGGACTTAATCAACGCAAGC). The qRT reaction was performed using Takara TB Green™ Premix Ex Taq™ II (Takara) and by using CFX-96 (Biorad).…”

A Pilot Study on the Effects of l-Carnitine and Trimethylamine-N-Oxide on Platelet Mitochondrial DNA Methylation and CVD Biomarkers in Aged Women

“…Epigenetic alterations (in particular DNA methylation) have been previously reported to play a role in CVD [16,17], gaining increasing interest in view of potential development of new therapeutic approaches [18,19], more efficient tools for early diagnosis [20] and personalized interventions [21]. While epigenetic regulation of nuclear DNA has been widely investigated, a relatively new field of research is represented by mitochondrial epigenetics [22][23][24][25]. Several studies identified variations of methylation levels in different areas of the mitochondrial genome, supporting the hypothesis that, similarly to nuclear epigenetics, mtDNA methylation could affect the expression of mitochondrial genes and mtDNA copy number as well [26][27][28][29][30].…”