Molecular Cloning and Characterization of the First Caspase in the Striped Stem Borer, Chilo suppressalis

Abstract

Apoptosis is executed through the activity of the caspases that are aspartyl-specific proteases. In this study, we isolated the caspase gene (Cscaspase-1) of Chilo suppressalis (one of the leading pests responsible for destruction of rice crops). It possesses the open reading frame (ORF) of 295 amino acids including prodomain, large subunit and small subunits, and two cleavage sites (Asp23 and Asp194) were found to be located among them. In addition to these profiles, Cscaspase-1 contains two active sites (His134 and Cys176). Genomic analysis demonstrated there was no intron in the genome of Cscaspase-1. The Cscaspase-1 transcripts were found in all tissues of the fifth instar larvae, and higher levels were found in the midgut, hindgut and Malpighian tubules. Examination of Cscaspase-1 expression in different developmental stages indicated low constitutive levels in the eggs and early larvae stages, and higher abundances were exhibited in the last larvae and pupae stages. The relative mRNA levels of Cscaspase-1 were induced by heat and cold temperatures. For example, the highest increase of Cscaspase-1 transcription was at −3 °C and 36 °C respectively. In a word, Cscaspase-1 plays a role of effector in the apoptosis of C. suppressalis. It also correlates with development, metamorphosis and thermotolerance of C. suppreassalis.

A COMPREHENSIVE STUDY ON APOPTOSIS INDUCTION BY AZADIRACHTIN IN Spodoptera frugiperda CULTURED CELL LINE Sf9

“…8), suggesting that azadirachtin could not mediate the process of apoptosis by inhibiting the activity of Topo Iin Sf9 cells. Caspase‐1, the first described member of the cysteine–aspartic acid protease (caspase) family, expresses in many tissues and may function in various developmental stages in S. frugiperda (Ahmad et al., ), D. melanogaster (Fraser et al., ), Bombyxmori (Pei et al., ), Heliothis virescens (Parthasarathy and Palli, ), Helicoverpa armigera (Yang et al., ), Musca domestica (Cheng et al., ), Plutella xylostella (Zhuang et al., ), and Chilo suppressalis (Lu et al., ). Caspase‐1 would play an important role in the execution phase of cell apoptosis in a variety of cell types.…”

Changes in immune responses, gene expression, and life table parameters of Helicoverpa armigera Hübner fed on a diet containing the saponin of tea plant, Camellia sinensis

“…Determination of cDNA goodness (For both control and saponin‐fed larvae) was carried by a reference gene (Control gene) using forward primer 5′‐CACGGGAAATCTCACCAGG‐3′ and reverse primer 3′‐CAGACAAATCGCTCCACCAACTA‐5′ (Lu et al, 2013). PCR was performed for 30 cycles at a denaturing temperature of 95°C for 2 min, 95°C for 30 s, at an annealing temperature of 57°C for 30 s, 72°C for 30 s, and at an extending temperature of 72°C for 5 min in a tube containing 25 ml of the reaction mixture as 1 ml cDNA templates, 2.5 ml reaction buffer, 0.5 µl dNTPs, 0.75 µl MgCl 2 , 0.25 µl Taq polymerase, 19 µl DEPC‐treated water, and 0.5 µl of forward and reverse primers in a thermocycler.…”

Characterization of a Digestive α-Amylase in the Midgut of Pieris brassicae L. (Lepidoptera: Pieridae)

“…The thermal cycling conditions were performed at temperature of 95°C for 2 min, 95°C for 30 s, 51°C for 30 s, 72°C for 30 s, and finally of 72°C for 5 min. Control gene in qRT-PCR was 18srRNA which amplified using a forward primer 5′- CACGGGAAATCTCACCAGG-3′ and a reverse primer 3′- CAGACAAATCGCTCCACCAACTA-5′ suggested by Lu et al ( 2013 ).…”