Molecular detection of Mycobacterium bovis in goats from Nagpur region of Maharashtra

Abstract

Tuberculosis is a zoonotic disease caused by bacteria; Mycobacterium species. It is distributed worldwide and have the economic and public health significance. The present study was carried out to detect and identify the presence of Mycobacterium pathogens using polymerase chain reaction in blood samples from goats. Blood samples from the total of 236 goats suspected of tuberculosis as well as apparently healthy were collected from in and around Nagpur region. The DNA in blood sample was assessed by PCR amplification of IS6110 and RD1, RD4 gene to detect Mycobacteria at genus and species level respectively. The overall positivity of M. bovis among goats was recorded as 10.59% (25/236). The study demands thorough testing of the flocks for continuous monitoring for tuberculosis for preventing its further spread.

First detection of bovine tuberculosis by Ziehl–Neelsen staining and polymerase chain reaction at dairy farms in the Lekok Sub-District, Pasuruan Regency, and Surabaya region, Indonesia

“…The PCR assay is the most convincing alternative approach for the rapid and specific diagnosis of TB [32]. It can detect the smallest trace of genetic material in a sample confirming exposure to the pathogen, does not require the isolation of the organism, and can detect DNA from both living and non-living organisms [20]. In the PCR test, even though the M. tuberculosis bacteria died, it was still detected because the DNA of the bacteria was detected [33].…”

“…We used the procedure described by Sonekar et al [20], with slight modifications, particularly in the initial denaturation time from 95°C for 7 min to 95°C for 2 min, and modifications in the annealing temperature from 59°C to 52°C for 1 min, as optimized in our study. The oligonucleotides used in this study were RD1 [21] and RD4 [22], with primary sequence RD1 (forward: CCC TTTCTCGTGTTTATACGTTTGA, reverse: GCCATATCGTCCGGAGCTT) and RD4 (forward: AATGGT TTGGTCATGACGCCTTC, reverse: CCCGTAGCG TTACTGAGAAATTGC).…”

“…The oligonucleotides used in this study were RD1 [21] and RD4 [22], with primary sequence RD1 (forward: CCC TTTCTCGTGTTTATACGTTTGA, reverse: GCCATATCGTCCGGAGCTT) and RD4 (forward: AATGGT TTGGTCATGACGCCTTC, reverse: CCCGTAGCG TTACTGAGAAATTGC). RD1 and RD4 were used to determine Mycobacterium spp., with reading of amplified PCR products at 110 bp and 176 bp positive for M. bovis, at 176 bp only positive for M. bovis BCG strain, and at 110 bp only positive for M. tuberculosis [20]. PCR reactions were performed in a total volume of 25 μL consisting of 12.5 μL GoTaq® Green Master Mix (Promega), 0.75 μL forward RD1, 0.75 μL reverse RD1, 0.5 μL forward RD4, 0.5 μL reverse RD4, 2 μL DNA template, and 8 μL nuclease-free water.…”

Risk Factors Associated with Prevalence of Zoonotic Tuberculosis in Small Ruminants in Chhattisgarh, India

“…The duplex PCR followed the protocol outlined by Sonekar et al (2021) with slight modifications. In the PCR reaction setup, components and concentrations were: 1X DreamTaq Green Buffer (1 μl), 200 μM dNTP mix (1 μl), 10 pm/μl Forward primer RD4 (0.5 μl), 10 pm μl -1 Reverse primer RD4 (0.5 μl), 10 pm μl -1 Forward primer RD1 (0.5 μl), 10 pm μl -1 Reverse primer RD1 (0.5 μl), Template DNA (2 μl), 3U μl -1 Taq Polymerase (0.2 μl), NF water (3.8 μl), resulting in a total reaction volume of 10 μl.…”

“…Tuberculosis remains a persistent concern in global sheep and goat farming, prompting extensive research on its prevalence and implications. Various studies, including those bySonekar et al (2021),Basit et al (2015) andZhang et al (2013) utilized PCR methods to identify and assess the prevalence of Mycobacterium species across different animal species, emphasizing disease control and zoonotic risks. In the Chhattisgarh region, direct detection of bovine TB in blood samples revealed an overall prevalence of 0.75%.…”