Molecular identification and prevalence of &lt;i&gt;Mycobacterium tuberculosis&lt;/i&gt; complex amongst people living with HIV in Osun state, Nigeria.

Alli, O. A. Terry; Ogbolu, David Olusoga; Salawu, M. A.; Oyedeji, J. G.; Oladokun, L.; Obaseki, F.

doi:10.4314/ajcem.v11i3.57765

Cited by 5 publications

(8 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…PCR to detect the presence or absence of IS6110 of M. tuberculosis complex DNA was carried out as described previously[ 4 9 ] was used for molecular detection of M. tuberculosis complex from clinical samples. After processing of sample using USP technology, 2 μl of the processed sample was added to the 18 μl PCR master mix containing Taq polymerase and IS6110F (cctgcgagcgtaggcgtcgg) and IS6110B (ctcgtccagcgccgcttcgg) primers.…”

Section: Methodsmentioning

confidence: 99%

“…Immunochromatographic technique for identification of M. tuberculosis complex from broth culture of mycobacteria has also joined methods for rapid diagnosis of TB[ 8 ]. We have recently shown that the identification of M. tuberculosis complex from culture using PCR[ 9 ] can reduce the time it takes for identification in this environment but this has not reduced the time it takes for culturing the aetiological agent from clinical samples. It is on the premise that we evaluated the detection of M. tuberculosis complex from clinical samples by PCR in order to determine the suitability of the test in our environment.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Direct molecular detection of Mycobacterium tuberculosis complex from clinical samples - An adjunct to cultural method of laboratory diagnosis of tuberculosis

Alli¹,

Alaka²

2011

North Am J Med Sci

View full text Add to dashboard Cite

Background:Tuberculosis, a communicable disease with significant morbidity and mortality, is the leading cause of death in the world from bacterial infectious disease. Because of its public health importance, there is need for rapid and definitive method of detecting the causative organism. Several approaches have been attempted, but the molecular methods, especially Polymerase Chain Reaction assays are the most promising for rapid detection of Mycobacterium tuberculosis complex from clinical samples.Aim:This study was aimed at using Polymerase Chain Reaction for detection of Mycobacterium tuberculosis complex from clinical samples using universal sample processing methodology.Subjects and Methods:Two hundred clinical samples sent to Tuberculosis laboratories in Ibadan and Osogbo, Nigeria, were enrolled in this study. The samples were processed by universal sample processing methodology for PCR; smear microscopy was carried out on sputum samples by Ziehl Nelseen staining technique; and cultured on Middlebrook agar medium containing oleic acid albumin dextrose complex supplement after decontamination of samples.Results:Ninety six (48%) samples were detected positive for M. tuberculosis complex by polymerase chain reaction using the combination of boiling and vortexing and microscopy detected 72 (36%) samples positive for acid fast bacilli. Using culture method as gold standard, it was found that polymerase chain reaction assay was more sensitive (75.5%) and specific (94.8%) than microscopy (sensitivity of 48.5% and specificity of 85.7%) in detecting M. tuberculosis complex from clinical samples. There was significant difference in detecting M. tuberculosis from clinical samples when compared to microscopy (p<0.05).Conclusion:The study recommends that direct molecular detection of M. tuberculosis complex is sensitive and specific and polymerase chain reaction method should be used as an adjunct to other methods of laboratory diagnosis of tuberculosis.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Direct molecular detection of Mycobacterium tuberculosis complex from clinical samples - An adjunct to cultural method of laboratory diagnosis of tuberculosis

Alli¹,

Alaka²

2011

North Am J Med Sci

View full text Add to dashboard Cite

show abstract

“…In another similar study, the prevalence of M. tuberculosis in people living with HIV in Osun state of Nigeria was found to be 25% using microscopy, 15% and 18.75% for M. tuberculosis and M. tuberculosis complex, respectively, suggesting there is overestimation of TB cases using microscopy. A positive association with occupation involving was also highlighted acquisition of M. avium complex infection [20].…”

Section: Tuberculosismentioning

confidence: 97%

Challenges of the Control of Opportunistic Infections of Zoonotic Origin in HIV/AIDS Patients

Adesiji¹,

Oloke²

2015

IJI

View full text Add to dashboard Cite

Abstract:The HIV/AIDS pandemic is associated with a number of opportunistic infections of immunocompromised person.Some of these infections are recognized zoonoses that are naturally transmitted between animals and humans. These may be directly transmitted by, animals or indirectly by contact with contaminated food and water. Interactions between animals and humans have a complex interplay and health care providers should be aware of the potential role of animals as reservoirs of infectious diseases for HIV infected patients. The most frequent pattern of infection is characterized either by direct contact with farm or wild animals and/or ingestion of their products. Immunomodulatory antibodies that enhance the immune system to promote the function of immune cells have great promise in preventing and treating opportunistic infections of zoonotic origin in HIV/AIDS patient.

show abstract

“…In smears stained with carbol fuschin or auramine and examined under the light microscope, the tubercle bacilli typically appear as straight or slightly curved rods but depending on growth conditions and age of the culture, bacilli may vary in size and shape from short coccobacilli to long rods. The dimensions of the bacilli have been reported to be 1-10µm in length (usually 3-5µm), and 0.2-0.6 µm in width (5,6).…”

Section: Introductionmentioning

confidence: 99%

“…Mycobacterium tuberculosis forms a complex that comprises members implicated in human tuberculosis. (10) while M. canetti is a rare MTBC strain which produces smooth and glossy colonies, with all cases so far isolated from people who have been to the horn of Africa (5,11); M. pinnipedii has been shown to be responsible for TB in marine host while M. caprae is responsible for TB in goats and M. microti infects larger mammals. Mycobacterium tuberculosis as the predominant cause of human TB is the most successful of human bacterial pathogens, and is sometimes referred to as Koch's bacillus after the discoverer (12).…”

Section: Introductionmentioning

confidence: 99%

Phenotypic characterization of mycobacteria isolates from tuberculosis patients in Kaduna State, Nigeria

Ahmadu¹,

Olonitola²,

Suleiman³

et al. 2019

Af J Clin Exp Micro

View full text Add to dashboard Cite

Background: Tuberculosis (TB) remains one of the leading public health challenges in Nigeria and the burden is still high. There is hence a need for continuous characterization of mycobacteria to obtain current data that will aid the ongoing TB prevention and control programme. The aim of this study was to phenotypically characterize mycobacteria isolates recovered from clinical specimens of patients with tuberculosis in Kaduna State, Nigeria. Methods: Two thousand, two hundred and twelve (2212) sputum samples were collected from patients clinically suspected to have TB in three different zones of Kaduna State, Nigeria, between May 2017 and October, 2018. Samples were processed by decontaminating with NaOH-Citrate N-acetyl-L-Cystein method for Ziehl Neelsen (ZN) AFB microscopy and culture on Lowenstein Jensen (LJ) slants which were incubated at 37 ᵒ C for 8 weeks. Positive LJ cultures were further analyzed with a rapid TB antigen assay (SD-Bioline) to differentiate Mycobacterium tuberculosis complex (MTBC) from Non Tuberculous Mycobacteria (NTM). Results: Out of the 2212 patients with suspected TB, 300 (13.6%) were positive for AFB by microscopy with Zone A (Kaduna North) having the highest AFB positive cases of 169 (15.2%). Of the 300 AFB positive samples, 272 (91.0%) were culture positive on LJ medium, 18 (6.0%) were culture negative and 10 (3.0%) were culture contaminated. Result of the distribution of mycobacteria among infected patients within the study area revealed that 219 (80.5%) were infected with MTBC, 42 (15.4%) with NTM and 11 (4.0%) with both MTBC and NTM. Conclusion: A relatively high number of TB in the study area was caused by NTM. There is need for advanced diagnostic tools that can differentiate MTBC and NTM strains among TB patients in all TB Reference Laboratories in Nigeria.

show abstract

Molecular identification and prevalence of <i>Mycobacterium tuberculosis</i> complex amongst people living with HIV in Osun state, Nigeria.

Abstract: Human immunodeficiency virus (HIV) infection has created a special niche for

Cited by 5 publications

References 31 publications

Direct molecular detection of Mycobacterium tuberculosis complex from clinical samples - An adjunct to cultural method of laboratory diagnosis of tuberculosis

Direct molecular detection of Mycobacterium tuberculosis complex from clinical samples - An adjunct to cultural method of laboratory diagnosis of tuberculosis

Challenges of the Control of Opportunistic Infections of Zoonotic Origin in HIV/AIDS Patients

Phenotypic characterization of mycobacteria isolates from tuberculosis patients in Kaduna State, Nigeria

Contact Info

Product

Resources

About