New Complex Recombinant Genotype of Hepatitis B Virus Identified in Vietnam

Abstract

Hepatitis B virus (HBV) infection is a global health problem.Approximately 350 million people worldwide are chronic carriers of the virus (12). Eight HBV genotypes from A to H are defined by a divergence in the entire nucleotide sequence of more than 8% (1,14,18,19,23). The prevalence and distribution of HBV genotypes vary geographically (6,8,9). Some genotypes have been split into subgroups. In particular, Asian strains of HBV (genotypes B and C) vary genetically and can be classified into various subgroups (21). In addition to these classifications, intergenotypic recombinant of HBV has been observed in geographical regions where there are cocirculating genotypes (2,3,5,11,20,25,26). We report here the complete genomic sequence and phylogenetic analyses of an HBV strain isolated in Vietnam that has shown a high divergence from these genotypes and also a novel complex recombinant.A serum sample was obtained from a 31-year-old male Vietnamese patient who lived in Hanoi, Vietnam. He was diagnosed with acute hepatitis B at Bach Mai Hospital, Hanoi, Vietnam, in 2003. This patient was seropositive for HBsAg and immunoglobulin M anti-HBc antibody with a high level of alanine transaminase (1,990 UI/liter). PCR using HBV genotype-specific primers (16) was used to amplify the virus genotype. The full-length 3.2 kb was amplified by using single-round amplification of the full HBV genome, using the primer pair HBV4 5Ј-CCGGAAAGCTTATGCTCTTCTTTTTCACCTC TGCCTAATCATC-3Ј (sense; underlining of the primer sequence indicates the HindIII site) and HBV4R 5Ј-CCGGAG AGCTCATGCTCTTCAAAAAGTTGCATGGTGCTGGT G-3Ј (antisense; underlining of the primer sequence indicates the SacI site) (4). PCR and sequencing analyses were done as described previously (17). Briefly, viral DNA was extracted from 100 l of serum by using a DNA/RNA extraction kit (SepaGene RV-R; Sanko Junyaku Co., Ltd., Tokyo, Japan).The resulting pellet was resuspended in 50 l of RNase-free water and kept at Ϫ20°C until use. The PCR conditions consisted of preincubation at 94°C and a 2-min activation of Blend Taq-Plus DNA polymerase (Toyobo, Ltd., Tokyo, Japan), followed by 40 cycles of PCR (94°C for 15 s, 55°C for 45 s, and 72°C for 3 min 20 s), with a final extension for 7 min at 72°C. The PCR products were separated by 1% agarose gel electrophoresis and purified by using a QIAquick gel extraction kit (Qiagen, Inc., Chatsworth, CA). Purified DNA was subjected to direct sequencing using an ABI Prism BigDye terminator cycle sequencing ready reaction kit and automated an ABI 3130 DNA sequencer (Applied Biosystems, Foster City, CA). Evolutionary and phylogenetic tree analysis were performed by using MEGA software version 3.0 (10), using the neighborjoining method, with 1,000 bootstrapped data sets. Genetic distance calculation and pairwise distance comparisons used the Kimura two-parameter model integrated into the MEGA software. Intergenotype recombination of HBV strains was investigated by using the SIMPLOT program version 3.5 (http: //sray.med.som.jhmi.edu/SCRoftware/simplot/ [...

When Should “I” Consider a New Hepatitis B Virus Genotype?

“…The same conclusion for the strains was reached by a later study using a new methodological approach (10). By providing neither additional information nor a new analytical approach, Huy et al (3) surprisingly conclude that their strain, with those previously reported, represent a new genotype.…”

“…Recently, Huy et al described a new hepatitis B virus (HBV) strain isolated in Vietnam (3) and claimed it to be a "new genotype," "HBV genotype I," with a complex recombination involving genotypes C, A, and G. We refute both claims.…”

“…1). In the pre-S/S regions, AB231908 formed variable, inconsistent outgroup associations with a range of genotypes, including A and G (originally identified as recombination partners by Huy et al [3], using SimPlot) and with chimpanzee variants (Fig. 1, gray line; Since 1988, when nucleotide diversity of Ͼ8% in the entire genome was first proposed for genotyping (9), eight genotypes have been described and named A to H (1,7,8,11), and their geographical distribution and clinical relevance have been extensively reported (5,6).…”

“…1. GroupScanning analysis (10) of VH24 against reference groups of nonrecombinant HBV sequences of human genotypes A to H and nonhuman ape-derived variants (chimpanzee/gibbon) (n ϭ 288), incorporating all HBV sequences used for recombination detection in the Huy et al study (3). Association values of approximately 0.5 or lower indicate an outgroup position or no phylogenetic clustering with a reference group.…”

Identification of novel recombinants of hepatitis B virus genotypes F and G in human immunodeficiency virus-positive patients from Argentina and Brazil

“…Eight genotypes (HBV/A to H) have been identified, representing divergence of .8 % in complete genomes (Arauz-Ruiz et al, 2002;Norder et al, 1994;Stuyver et al, 2000). Two additional genotypes, I and J, have been proposed (Olinger et al, 2008;Tatematsu et al, 2009;Huy et al, 2008). There is diversity within genotypes, some genotypes being divided into subgenotypes (Norder et al, 2004).…”