Hepatitis B virus (HBV) infection is a global health problem.Approximately 350 million people worldwide are chronic carriers of the virus (12). Eight HBV genotypes from A to H are defined by a divergence in the entire nucleotide sequence of more than 8% (1,14,18,19,23). The prevalence and distribution of HBV genotypes vary geographically (6,8,9). Some genotypes have been split into subgroups. In particular, Asian strains of HBV (genotypes B and C) vary genetically and can be classified into various subgroups (21). In addition to these classifications, intergenotypic recombinant of HBV has been observed in geographical regions where there are cocirculating genotypes (2,3,5,11,20,25,26). We report here the complete genomic sequence and phylogenetic analyses of an HBV strain isolated in Vietnam that has shown a high divergence from these genotypes and also a novel complex recombinant.A serum sample was obtained from a 31-year-old male Vietnamese patient who lived in Hanoi, Vietnam. He was diagnosed with acute hepatitis B at Bach Mai Hospital, Hanoi, Vietnam, in 2003. This patient was seropositive for HBsAg and immunoglobulin M anti-HBc antibody with a high level of alanine transaminase (1,990 UI/liter). PCR using HBV genotype-specific primers (16) was used to amplify the virus genotype. The full-length 3.2 kb was amplified by using single-round amplification of the full HBV genome, using the primer pair HBV4 5Ј-CCGGAAAGCTTATGCTCTTCTTTTTCACCTC TGCCTAATCATC-3Ј (sense; underlining of the primer sequence indicates the HindIII site) and HBV4R 5Ј-CCGGAG AGCTCATGCTCTTCAAAAAGTTGCATGGTGCTGGT G-3Ј (antisense; underlining of the primer sequence indicates the SacI site) (4). PCR and sequencing analyses were done as described previously (17). Briefly, viral DNA was extracted from 100 l of serum by using a DNA/RNA extraction kit (SepaGene RV-R; Sanko Junyaku Co., Ltd., Tokyo, Japan).The resulting pellet was resuspended in 50 l of RNase-free water and kept at Ϫ20°C until use. The PCR conditions consisted of preincubation at 94°C and a 2-min activation of Blend Taq-Plus DNA polymerase (Toyobo, Ltd., Tokyo, Japan), followed by 40 cycles of PCR (94°C for 15 s, 55°C for 45 s, and 72°C for 3 min 20 s), with a final extension for 7 min at 72°C. The PCR products were separated by 1% agarose gel electrophoresis and purified by using a QIAquick gel extraction kit (Qiagen, Inc., Chatsworth, CA). Purified DNA was subjected to direct sequencing using an ABI Prism BigDye terminator cycle sequencing ready reaction kit and automated an ABI 3130 DNA sequencer (Applied Biosystems, Foster City, CA). Evolutionary and phylogenetic tree analysis were performed by using MEGA software version 3.0 (10), using the neighborjoining method, with 1,000 bootstrapped data sets. Genetic distance calculation and pairwise distance comparisons used the Kimura two-parameter model integrated into the MEGA software. Intergenotype recombination of HBV strains was investigated by using the SIMPLOT program version 3.5 (http: //sray.med.som.jhmi.edu/SCRoftware/simplot/ [...

In Asia, genotypes B and C are the most common genotypes of hepatitis B virus (HBV); and genotype C causes more severe liver disease. Core promoter/precore (CP/PC) mutants, known to be linked to these genotypes, could have an impact on the progression and severity of liver disease. Sera of 115 patients, including 39 acute and 76 chronic Vietnamese HBV infected patients, were tested for their liver profile, HBeAg, HBV genotypes, and HBV DNA level. Fragments of 282 nucleotides covering CP/PC were amplified, sequenced, and analysed. In the acute group, CP/PC mutants accounted for 38.4 and 25.6%, respectively. Genotype B was found to be predominant (74.3%, P < 0.05) and linked to the PC mutant (A1896) (P < 0.05). In the chronic group, CP/PC mutants accounted for 61.7 and 32.8%. CP mutants, especially the T1762/A1764 double mutant, were found to correlate with genotype C (81%, P < 0.001), liver cirrhosis, and hepatocellular carcinoma (P < 0.05). Therefore, genotype C in Vietnam, which carried high rate of C-1858 (70%), could play an important role in causing severe chronic liver disease.

The present paper provides a review of the current literature regarding the molecular-based epidemiology of hepatitis B virus (HBV) and hepatitis C virus (HCV), which are very important viruses underlying the etiology of blood-borne infectious diseases worldwide. Particularly, both HBV and HCV are widespread on the Asian continent and are associated with acute and chronic liver diseases, including hepatocellular carcinoma. HBV has been classified into genotypes A through G and shown to have a distinct geographic distribution. In Asia, genotypes B and C of HBV prevail, and genotype C has been shown to cause more serious liver disease than genotype B. High prevalence of HBV mutants with various forms, such as the pre-S mutant, basal core promoter mutant, YMDD motif mutant and vaccine escape mutant, were seen in Asia and these were found to be related to the severity of liver disease and sensitivity to therapy. HCV has also been classified into multiple genotypes and associated with geographic distribution. HCV genotype 1 is less sensitive to interferon therapy and may be associated with the presence of more serious liver disease than the other genotypes. Data on the relation among the HBV/HCV genotypes, their pathogenicity in chronic liver diseases including hepatocellular carcinoma and their effect on therapy are awaited with great interest, especially in Asia, which is an endemic region of blood-borne hepatitis viruses.