Novel splice site mutation in the fumarate hydratase (<i>FH</i>) gene is associated with multiple cutaneous leiomyomas in a Japanese patient

Yoshinaga, Y.; Nakai, Hiroyuki; Ito, Akiko; Kariya, Naoyuki; Ito, Masaaki; Shimomura, Yutaka

doi:10.1111/1346-8138.13019

Cited by 5 publications

(7 citation statements)

References 28 publications

(63 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Five previously reported Japanese families with HLRCC exhibited different mutations, including four missense mutations and a splice site mutation that have not been reported in Caucasian families. [11][12][13][14][15] These mutations together with the novel mutation pattern detected in the current case indicate the existence of several founders in Japan harboring FH mutations distinct from those detected in Caucasian families.…”

Section: Discussionsupporting

confidence: 57%

“…Although the case did not meet the clinical diagnostic criteria of HLRCC, cumulative information of renal histopathology after the patient's death made us investigate the possibility of FH mutation. Five previously reported Japanese families with HLRCC exhibited different mutations, including four missense mutations and a splice site mutation that have not been reported in Caucasian families . These mutations together with the novel mutation pattern detected in the current case indicate the existence of several founders in Japan harboring FH mutations distinct from those detected in Caucasian families.…”

Section: Discussionsupporting

confidence: 47%

“…Yoshinaga et al . analyzed a patient harboring a splice site mutation in FH that results in exon 5 skipping, predicted to encode a truncated FH protein . The skin lesion in their patient showed LOH for FH .…”

Section: Discussionmentioning

confidence: 99%

See 2 more Smart Citations

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase

Matsumoto

Udaka

Hasumi

et al. 2018

Pathology International

View full text Add to dashboard Cite

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

show abstract

Section: Discussionsupporting

confidence: 57%

Section: Discussionsupporting

confidence: 47%

See 1 more Smart Citation

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase

Matsumoto

Udaka

Hasumi

et al. 2018

Pathology International

View full text Add to dashboard Cite

show abstract

“…FH is a homotetrameric protein present in two isoforms coded by the same gene, a mitochondrial isoform involved in the conversion of fumarate to malate in the TCA cycle, and a cytosolic isoform involved in amino acid catabolism and the urea cycle (Yogev et al , ). FH germline mutations, which are often missense mutations and are particularly frequent in exons 4, 5, 7 and 8 (Bayley, Launonen, & Tomlinson, ; Picaud et al , ; Yoshinaga et al , ), have been found to decrease FH activity with the consequent accumulation of fumarate. Decreased functionality of FH predisposes individuals to several pathologies including multiple cutaneous leiomyomas, uterine leiomyomas, and the familial syndrome hereditary leiomyomatosis and renal cell cancer (HLRCC), which causes smooth muscle tumours and renal cell carcinomas (Bayley et al , ; Ha et al , ).…”

Section: Oncometabolites and Their Related Metabolic Enzymesmentioning

confidence: 99%

Oncometabolites in cancer aggressiveness and tumour repopulation

et al. 2019

View full text Add to dashboard Cite

Tumour repopulation is recognized as a crucial event in tumour relapse where therapy-sensitive dying cancer cells influence the tumour microenvironment to sustain therapy-resistant cancer cell growth. Recent studies highlight the role of the oncometabolites succinate, fumarate, and 2-hydroxyglutarate in the aggressiveness of cancer cells and in the worsening of the patient's clinical outcome. These oncometabolites can be produced and secreted by cancer and/or surrounding cells, modifying the tumour microenvironment and sustaining an invasive neoplastic phenotype. In this review, we report recent findings concerning the role in cancer development of succinate, fumarate, and 2-hydroxyglutarate and the regulation of their related enzymes succinate dehydrogenase, fumarate hydratase, and isocitrate dehydrogenase. We propose that oncometabolites are crucially involved in tumour repopulation. The study of the mechanisms underlying the relationship between oncometabolites and tumour repopulation is fundamental for identifying efficient anti-cancer therapeutic strategies and novel serum biomarkers in order to overcome cancer relapse.

show abstract

“…Most clinically relevant missense mutations affect residues that are evolutionarily conserved [ 39 , 40 ]. Other mutations, such as deletions or splice-site mutations, often result in omission of whole segments of the protein and thus cause severe disruptions in conformation of the protein [ 25 , 41 , 42 ]. Overall, mutations in FH seem to cause structural changes to the enzyme that eliminate or compromise enzymatic function.…”

Section: Introductionmentioning

confidence: 99%

Biochemical Characterization of Two Clinically-Relevant Human Fumarase Variants Defective for Oligomerization

Bulku¹,

Weaver²,

Berkmen³

2018

Open Biochem. J.

View full text Add to dashboard Cite

Background:Fumarase, a significant enzyme of energy metabolism, catalyzes the reversible hydration of fumarate to L-malate. Mutations in the FH gene, encoding human fumarase, are associated with fumarate hydratase deficiency (FHD) and hereditary leiomyomatosis and renal cell cancer (HLRCC). Fumarase assembles into a homotetramer, with four active sites. Interestingly, residues from three of the four subunits within the homotetramer comprise each active site. Hence, any mutation affecting oligomerization is predicted to disrupt enzyme activity.Methods:We constructed two variants of hexahistidine-tagged human recombinant fumarase, A308T and H318Y, associated with FHD and HLRCC, respectively. Both Ala308 and His318 lie within the fumarase intersubunit interface. We purified unmodified human fumarase and the two variants, and analyzed their enzymatic activities and oligomerization states in vitro.Results:Both variants showed severely diminished fumarase activity. Steady-state kinetic analysis demonstrated that the variants were largely defective due to decreased turnover rate, while displaying Km values for L-malate similar to unmodified human recombinant fumarase. Blue native polyacrylamide gel electrophoresis and gel filtration experiments revealed that each variant had an altered oligomerization state, largely forming homodimers rather than homotetramers.Conclusion:We conclude that A308T and H318Y render human fumarase enzymatically inactive via defective oligomerization. Therefore, some forms of FHD and HLRCC can be linked to improperly folded quaternary structure.

show abstract

Novel splice site mutation in the fumarate hydratase (FH) gene is associated with multiple cutaneous leiomyomas in a Japanese patient

Cited by 5 publications

References 28 publications

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase

Oncometabolites in cancer aggressiveness and tumour repopulation

Biochemical Characterization of Two Clinically-Relevant Human Fumarase Variants Defective for Oligomerization

Contact Info

Product

Resources

About