Nucleotide sequence of a region downstream of the mouse C<sup>K</sup>immunoglobulin gene

Neumaier, Peter S.; Zachau, Hans G.

doi:10.1093/nar/11.11.3631

Cited by 13 publications

(5 citation statements)

References 23 publications

(19 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Nucleotide sequence of rearranged MOPC-167 a gene beginning at position 222 of the germline sequence (23) . Comparison of the MOPC-167 a gene sequence with the Ja5-Ca intron germline sequence (19,28,29) confirmed differences previously observed by Gearhart and Bogenhagen (3), and revealed further alterations . The nature of the changes and their positions are listed below.…”

supporting

confidence: 86%

Analysis of somatic mutations in kappa transgenes.

Hackett

Rogerson

O’Brien

et al. 1990

The Journal of Experimental Medicine

View full text Add to dashboard Cite

SummaryWe have examined the nature and localization of somatic mutations in three tc transgenes cloned from IgG-secreting hybridomas. All of the mutations identified were single base substitutions. Mutations were localized to the variable (V) region and its flanking sequences. In every case, the nuclear matrix association region, K enhancer, and C gene were spared. These data indicate that the rearranged « gene contains the necessary sequences for targeting of the mutation process, and suggest that the observed localization of mutations to the V region reflects the inherent specificity of this mutation process.

show abstract

supporting

confidence: 86%

Analysis of somatic mutations in kappa transgenes.

Hackett

Rogerson

O’Brien

et al. 1990

The Journal of Experimental Medicine

View full text Add to dashboard Cite

show abstract

“…1. In addition, Cy1 (23), Cy2b (23), CK (24), Vx1 (25), CK1 (26), H-2d-lb (27), and PAcpr (28) were used. Nuclear Run-On Transcription Assay.…”

Section: Methodsmentioning

confidence: 99%

“…The pattern of p.-specific mRNA in LPS/anti-p. F(ab')2-treated cultures was again quite different. There was either a considerable reduction of p, mRNA (by a factor of [20][21][22][23][24][25][26][27][28][29][30] or an almost total loss (reduction by a factor of 100-200) (Fig. 3A), whereas a weak but apparent band of gm, mRNA remained (Fig.…”

Section: Methodsmentioning

confidence: 99%

IgM RNA switch from membrane to secretory form is prevented by adding antireceptor antibody to bacterial lipopolysaccharide-stimulated murine primary B-cell cultures.

Chen-Bettecken¹,

Wecker²,

Schimpl³

1985

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Bacterial lipopolysaccharide (LPS) induces proliferation of resting primary murine B lymphocytes and their differentiation into Ig-secreting cells. This is accompanied by an increase in the rate of Ig gene transcription and the accumulation of jp heavy chain secretory mRNA. Specific antiantigen receptor antibody (anti-p) induces resting B cells to proliferation but not differentiation. Upon addition of both LPS and anti-p to cultures, resting B cells again proliferate but do not differentiate. RNA transfer blots of the Ig mRNA 2 days after induction with LPS/anti-pz show a specific deficiency of the 2.4-kilobase (kb) pz secretory mRNA, whereas the levels of the 2.7-kb pz membrane and 1.2-kb K light chain mRNAs are as high as in cells treated with LPS alone. Between days 3 and 4 after treatment with both reagents, reductions of pA membrane and, to a smaller extent, K mRNA become apparent. As measured by nuclear run-on transcription experiments at day 2, the transcription rates ofIg pand the Ig Ktranscription units are equal in both induction experiments. Only at later stages do the LPS/anti-pt-treated cells transcribe Ig genes at a lower rate. Thus, the anti-p treatment, drastically reducing the p secretory mRNA production at early stages, represents a negative regulation occurring primarily at the posttranscriptional level.Activation of murine B cells proceeds in at least two steps leading to proliferation and, in a distinct event, to Ig secretion. The signals involved under physiological conditions seem to be mediated (i) via the antigen (Ag)-receptor, guaranteeing clonal selection, and (ii) via carrier with major histocompatibility complex (MHC) class II-mediated recognition of B cells by T cells. The latter provide either the transfer of a direct membrane signal and/or the proximity required for the transfer of T-cell-derived factors instrumental in B-cell growth and differentiation.Due to the lack of sufficient Ag-specific B cells, the detailed molecular events taking place during these individual steps cannot as yet be studied in Ag/T-helper-driven systems. Two alternative approaches are available: stimulation of B cells by (i) the polyclonal mitogen bacterial lipopolysaccharide (LPS), which, however, drives both proliferation and differentiation to Ig secretion and therefore does not allow the study of individual controls of these two steps, or

show abstract

“…14/20 (15,27); a 568 bp EcoRI/BglII fragment for the Bl-globin gene (19); and a 170 bp HaeIII fragment for the ovalbumin gene (18). The sequences of these termination fragments were analyzed for homology (see Materials and Methods).…”

Section: L1md (Mifc70) a A A Ga C O T G A A Gaa A C A Atmentioning

confidence: 99%

Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element

Frayne

Kellems

1986

Nucl Acids Res

View full text Add to dashboard Cite

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.

show abstract

Nucleotide sequence of a region downstream of the mouse C^Kimmunoglobulin gene

Cited by 13 publications

References 23 publications

Analysis of somatic mutations in kappa transgenes.

Analysis of somatic mutations in kappa transgenes.

IgM RNA switch from membrane to secretory form is prevented by adding antireceptor antibody to bacterial lipopolysaccharide-stimulated murine primary B-cell cultures.

Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element

Contact Info

Product

Resources

About

Nucleotide sequence of a region downstream of the mouse CKimmunoglobulin gene

Cited by 13 publications

References 23 publications

Analysis of somatic mutations in kappa transgenes.

Analysis of somatic mutations in kappa transgenes.

IgM RNA switch from membrane to secretory form is prevented by adding antireceptor antibody to bacterial lipopolysaccharide-stimulated murine primary B-cell cultures.

Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element

Contact Info

Product

Resources

About

Nucleotide sequence of a region downstream of the mouse C^Kimmunoglobulin gene