Overlapping sites for constitutive and induced DNA binding factors involved in interferon-stimulated transcription.

Abstract

A 14 bp interferon (IFN)‐stimulated response element (ISRE) from 6‐16, a human gene regulated by alpha‐IFN, confers IFN inducibility on a heterologous thymidine kinase promoter. A 39 bp double‐stranded oligonucleotide corresponding to a 5′ region of 6‐16 which includes the ISRE competes for factors required for gene expression by alpha‐IFN in transfected cells and a single base change (A‐11 to C) within the ISRE (GGGAAAATGAAACT) abolishes this competition. Band‐shift assays performed with whole‐cell extracts and the 39 bp oligonucleotide reveal specific complexes formed by rapidly induced and constitutive factors, both of which fail to bind to the A‐11 to C oligonucleotide. A detailed footprinting analysis reveals that these two types of factors bind to overlapping sites within the ISRE, but in very different ways. These data were used to design oligonucleotides which decreased the formation of the inducible complex without affecting the constitutive one. Changes at the 5′ margin of the ISRE and upstream of it markedly decrease formation of the induced but not the constitutive complex and also abolish the ability of the 39 bp sequence to function as an inducible enhancer with the thymidine kinase promoter. Thus, induction of 6‐16 transcription in IFN‐treated cells is likely to be stimulated by binding of the induced factor to the ISRE and upstream sequences, while the subsequent suppression of transcription may involve competition for the ISRE by the other class of factors.

The interferon‐stimulable response elements of two human genes detect overlapping sets of transcription factors

“…I. Goldsmith (Imperial Cancer Research Fund, UK), HPLC purified, ethanol precipitated and dissolved in 10 mM Tris/HCl, 1 mM EDTA, pH7.2. The concentrations of the oligodeoxynucleotides were determined by their absorbance at 260 nM and annealing and labelling was as described previously [7]. The following were used, double stranded, as labelled probes or competitor oligodeoxynucleotides : the 'core' 14-nucleotide ISRE are printed in bold face and mutant base changes are underlined: 9-27 wild-type, -185 to 147 [5] [29], GAAATGGAAATGGAAATGGAAATG ; nonsense (N) GATCCGAATTCGAGCTCATCCGAATTC-GAGC AAGCTTGCATGCG.…”

“…Composition of band-shift complexes detected with 6-16 and 9-27 ISRE probes. M, G, C1/C2 and ISGFl -3 are the alternative names given to ISRE probe-specific complexes detected by our own [7,81 or the Darnell group (ISGF1-3; 3, 10, 12, 13) respectively. The probe given is that for the work described here and previously from our group.…”

“…Previous DNA footprint and mutational analysis of the ISGF3 (E) complexes indicated protein-DNA contacts both in the 14-nucleotide 'core' ISRE and the 5' and 3' flanking sequences [7,13,351. 'Flank-swap' experiments, in which the central 14-nucleotide ISRE were exchanged between the 39-nucleotide 6-16 and 9-27 probes, confirmed the importance of flanking sequences for high affinity binding of E [8].…”

“…1-61. We have previously reported three types of DNA-protein complexes that are specifically formed with the ISRE in band-shift assays [7,81. (a) An early complex involves factor E, also known as ISGF3 (interferon-stimulated gene factor 3) [3].…”

Molecular analysis of a human interferon‐inducible gene family

“…The 1-8U and 1-8D genes are extremely similar: each is contained within a <2-kb fragment, has in its S'flanking region two adjacent 14-base-pair sequences showing high similarity to interferon-stimulable response elements (ISREs) and has two highly related exons. The third gene (9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20)(21)(22)(23)(24)(25)(26)(27)) has a similar overall structure, shows substantial similarity to the 1-8s but has only one ISRE which is 3' of two CCAAT boxes not present in the 1-8U and D genes. The cDNAs corresponding to the three genes share 120 nucleotides of identical sequence and show > 90% identity over 70% of the coding sequence.…”