Phenotypic assessment and mapped markers for H31, a new wheat gene conferring resistance to Hessian fly (Diptera: Cecidomyiidae)

Williams, Christie E.; Collier, Chad C.; Sardesai, Nagesh; Ohm, H. W.; Cambron, S. E.

doi:10.1007/s00122-003-1393-y

Cited by 63 publications

(52 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…A set of 18 barley ESTs and 3 RFLPs mapped in distal position on 5HS (Stein et al 2007) was kindly provided by N. Stein (Institute of Plant Genetics and Crop Plant Research-IPK, Gatersleben, Germany). The primer pair F-59 TCCTACCTCCATTCCCCTTT 39 and R-59 TCAAAAT GAATCGGAAGGGT 39 was used to amplify the STS-E41M48 marker utilizing the PCR conditions described in Williams et al (2003).…”

Section: Methodsmentioning

confidence: 99%

Fine Mapping and Marker Development for the Crossability Gene SKr on Chromosome 5BS of Hexaploid Wheat (Triticum aestivum L.)

et al. 2009

View full text Add to dashboard Cite

Most elite wheat varieties cannot be crossed with related species thereby restricting greatly the germplasm that can be used for alien introgression in breeding programs. Inhibition to crossability is controlled genetically and a number of QTL have been identified to date, including the major gene Kr1 on 5BL and SKr, a strong QTL affecting crossability between wheat and rye on chromosome 5BS. In this study, we used a recombinant SSD population originating from a cross between the poorly crossable cultivar Courtot (Ct) and the crossable line MP98 to characterize the major dominant effect of SKr and map the gene at the distal end of the chromosome near the 5B homeologous GSP locus. Colinearity with barley and rice was used to saturate the SKr region with new markers and establish orthologous relationships with a 54-kb region on rice chromosome 12. In total, five markers were mapped within a genetic interval of 0.3 cM and 400 kb of BAC contigs were established on both sides of the gene to lay the foundation for map-based cloning of SKr. Two SSR markers completely linked to SKr were used to evaluate a collection of crossable wheat progenies originating from primary triticale breeding programs. The results confirm the major effect of SKr on crossability and the usefulness of the two markers for the efficient introgression of crossability in elite wheat varieties.

show abstract

Section: Methodsmentioning

confidence: 99%

Fine Mapping and Marker Development for the Crossability Gene SKr on Chromosome 5BS of Hexaploid Wheat (Triticum aestivum L.)

et al. 2009

View full text Add to dashboard Cite

show abstract

“…To date, 33 major HF resistance (HFR) genes have been identified from wheat and its relatives (Ratcliffe and Hatchett 1997;Harris et al 2003;Martín-Sánchez et al 2003;McIntosh et al 2003;Williams et al 2003;Liu et al 2005a;Sardesai et al 2005). Many of these resistance genes have been mapped to various wheat chromosomes across three genomes.…”

Section: Introductionmentioning

confidence: 99%

Identification of a novel gene, H34, in wheat using recombinant inbred lines and single nucleotide polymorphism markers

Chen

Chao

et al. 2013

Theor Appl Genet

View full text Add to dashboard Cite

“…Resistance to Hessian fly attack is achieved through R gene-mediated resistance (Hatchett and Gallun, 1970). So far, 32 distinct Hessian fly resistance genes have been identified (Williams et al, 2003;Sardesai et al, 2005a). Interactions with Hessian fly elicit two types of responses in wheat: susceptibility to the larvae, a compatible interaction; and resistance to the larvae, an incompatible interaction.…”

mentioning

confidence: 99%

Functional Characterization of HFR1, a High-MannoseN-Glycan-Specific Wheat Lectin Induced by Hessian Fly Larvae

et al. 2008

View full text Add to dashboard Cite

We previously cloned and characterized a novel jacalin-like lectin gene from wheat (Triticum aestivum) plants that responds to infestation by Hessian fly (Mayetiola destructor) larvae, a major dipteran pest of this crop. The infested resistant plants accumulated higher levels of Hfr-1 (for Hessian fly-responsive gene 1) transcripts compared with uninfested or susceptible plants. Here, we characterize the soluble and active recombinant His 6 -HFR1 protein isolated from Escherichia coli. Functional characterization of the protein using hemagglutination assays revealed lectin activity. Glycan microarray-binding assays indicated strong affinity of His 6 -HFR1 to Mana1-6(Mana1-3)Man trisaccharide structures. Resistant wheat plants accumulated high levels of HFR1 at the larval feeding sites, as revealed by immunodetection, but the avirulent larvae were deterred from feeding and consumed only small amounts of the lectin. Behavioral studies revealed that avirulent Hessian fly larvae on resistant plants exhibited prolonged searching and writhing behaviors as they unsuccessfully attempted to establish feeding sites. During His 6 -HFR1 feeding bioassays, Drosophila melanogaster larvae experienced significant delays in growth and pupation, while percentage mortality increased with progressively higher concentrations of His 6 -HFR1 in the diet. Thus, HFR1 is an antinutrient to dipteran larvae and may play a significant role in deterring Hessian fly larvae from feeding on resistant wheat plants.

show abstract

Phenotypic assessment and mapped markers for H31, a new wheat gene conferring resistance to Hessian fly (Diptera: Cecidomyiidae)

Cited by 63 publications

References 30 publications

Fine Mapping and Marker Development for the Crossability Gene SKr on Chromosome 5BS of Hexaploid Wheat (Triticum aestivum L.)

Fine Mapping and Marker Development for the Crossability Gene SKr on Chromosome 5BS of Hexaploid Wheat (Triticum aestivum L.)

Identification of a novel gene, H34, in wheat using recombinant inbred lines and single nucleotide polymorphism markers

Functional Characterization of HFR1, a High-MannoseN-Glycan-Specific Wheat Lectin Induced by Hessian Fly Larvae

Contact Info

Product

Resources

About