Phylogenetic analysis of Anguilla marmorata population in Thua Thien Hue, Vietnam based on the cytochrome C oxidase I (COI) gene fragments

Huyen, Kieu Thi; Linh, Nguyen Quang

doi:10.1186/s13568-020-01059-7

Cited by 4 publications

(4 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The molecular phylogenetic tree and the haplotype network of A. marmorata in Malaysia, Thailand and Vietnam suggested that the eel might be transported from the Western North Pacific spawning area and propose possible dispersion and migration of A. marmorata into Southeast Asian waters. In Thua Thien Hue province, DNA barcode techniques used to analyze molecular characteristics and build phylogenetic based on the COI segment showed that separation of the A. marmorata population is guided by the migration process and specific ecological parameters (Huyen and Linh, 2020) and their genetic evolution occurs in the direction of random population expansion (Linh and .…”

Section: Discussionmentioning

confidence: 99%

“…DNA extraction and sequence analysis Total genomic DNA was extracted by the method descriped by Kumar et al (2007) with a modification. The PCRs were carried out using two primer pairs: A.marFw-1-5'GCACTAAGCTTCTAATCCG3' and A.marRv-1-5' GATGATTATTGTGGCAGAAG3' (Huyen and Linh, 2020) for amplification of the COI gene; L2510 (5′CGC CTG TTT ATC AAA AAC AT3′) and H3080 (5′CCG GTC TGA ACT CAG ATC ACG T3′) (Palumbi et al, 1991) for amplification of 16S rRNA gene. The amplification reactions were performed in a total volume of 35 μL.…”

Section: Morphological Analysismentioning

confidence: 99%

See 1 more Smart Citation

Research Article Using DNA barcodes based on mitochondrial COI and 16S rRNA genes to identify Anguilla eels in Thua Thien Hue province, Vietnam

Huyen¹,

Nghia²,

Ngoc³

et al. 2020

Genet. Mol. Res.

View full text Add to dashboard Cite

In Vietnam, Anguilla eels have been documented before, but their species composition and biological characteristics are still relatively unknown. Research on the molecular phylogeny of Anguilla has been limited, and identification of the species of eels was usually based on morphological characteristics. This is the first time both cytochrome c oxydase subunit I (COI) and 16S ribosomal RNA (rRNA) genes were used to identify Anguilla eels in water bodies, where the eels can migrate downstream and upstream during different stages of the life cycle, in Thua Thien Hue province, Vietnam. Based on DNA sequence analysis of six specimens, two Anguilla species (including subspecies) were confirmed as A. marmorata and A. bicolor pacifica, which had not been identified based on morphological characteristics in previous analyses. ©FUNPEC-RP www.funpecrp.com.br Genetics and Molecular Research 19 (4): gmr18722 K.T. Huyen et al. 2 Phylogenetic analysis showed that the Anguilla genus in Thua Thien Hue province belongs to the Indo-Pacific lineage and helped build phylogenetic trees generated from mtDNA data from GenBank for these eels.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Morphological Analysismentioning

confidence: 99%

Research Article Using DNA barcodes based on mitochondrial COI and 16S rRNA genes to identify Anguilla eels in Thua Thien Hue province, Vietnam

Huyen¹,

Nghia²,

Ngoc³

et al. 2020

Genet. Mol. Res.

View full text Add to dashboard Cite

show abstract

“…This induces then isolation by time (IBT) of spawning groups. individuals in eel populations in Thua Thien Hue and it was divided into two separate groups that are guided by the migration process and speci c ecological (Huyen and Linh 2020).…”

Section: Discussionmentioning

confidence: 99%

Multiple population structure of the giant eel Anguilla marmorata in Thua Thien Hue, Vietnam base on COI sequences

Linh

Huyen

2020

Preprint

Self Cite

View full text Add to dashboard Cite

The giant mottled eel Anguilla marmorata is a species of great economic, ecological, and conservative values in the Southeast Asian region. The research aims to conservation and evaluation of the genetic diversity of A. marmorata populations living in Thua Thien Hue (TTH), Vietnam. The sequencing of the barcode region of the cytochrome c oxidase subunit 1 gene was carried out for 48 individuals of A. marmorata elvers, which were collected from five different ecosystem regions. The sequences were analyzed using various genetic, phylogenetic, and population analyses to assess their variability. A total of 20 polymorphic sites and 17 haplotypes were identified. Extremely low fixation (Fst = -0.073 – 0.003; < 0.05) was found for A. marmorata populations in the region. The populations showed signs of recent populations’ expansion, besides negative Tajima’s D test, Fu’s Fs, Fu and Li’s D* and F* test values. The genetic evolution of eel occurs in a randomized pattern over a large population, with the likelihood of rare alleles appearing in the population. In TTH (Viet Nam) territories, we indicated the five areas for conservation units with moderate eels’ populations’ diversity.

show abstract

“…IBT causes a restriction in gene ow, taking place between early and late spawners (Hendry and Day 2005). And the last, based on analyzed three different phylogenetic trees of A. marmorata population in Thua Thien Hue, Vietnam, Huyen and Linh (2020) showed that there was the high genetic similarity of individuals in eel populations in Thua Thien Hue and it was divided into two separate groups that are guided by the migration process and speci c ecological (Huyen and Linh 2020).…”

Section: Discussionmentioning

confidence: 99%

Multiple population structure of the giant eel Anguilla marmorata in Thua Thien Hue, Vietnam base on COI sequences

Linh

Huyen

2020

Preprint

Self Cite

View full text Add to dashboard Cite

The giant mottled eel Anguilla marmorata is a species of great economic, ecological, and conservative values in the Southeast Asian region. The research aims to conservation and evaluation of the genetic diversity of A. marmorata populations living in Thua Thien Hue, Vietnam. The sequencing of the barcode region of the cytochrome c oxidase subunit 1 gene was carried out for 48 individuals of A. marmorata , which were collected from five different ecosystem regions. The sequences were analyzed using various genetic, phylogenetic, and population analyses to assess their variability. A total of 20 polymorphic sites and 17 haplotypes were identified. Very low fixation (Fst = -0.073 – 0.003; < 0.05) was found for A. marmorata populations in the region. The populations showed signs of recent populations’ expansion, besides negative Tajima’s D test, Fu’s Fs, Fu and Li’s D* and F* test values. The genetic evolution of eel occurs in a randomized pattern over a large population, with the likelihood of rare alleles appearing in the population. In Thua Thien Hue (Viet Nam) territories, we indicated the five areas for conservation units with moderate eels’ populations’ diversity.

show abstract

Phylogenetic analysis of Anguilla marmorata population in Thua Thien Hue, Vietnam based on the cytochrome C oxidase I (COI) gene fragments

Cited by 4 publications

References 32 publications

Research Article Using DNA barcodes based on mitochondrial <i>COI</i> and <i>16S</i> <i>rRNA</i> genes to identify <i>Anguilla</i> eels in Thua Thien Hue province, Vietnam

Research Article Using DNA barcodes based on mitochondrial <i>COI</i> and <i>16S</i> <i>rRNA</i> genes to identify <i>Anguilla</i> eels in Thua Thien Hue province, Vietnam

Multiple population structure of the giant eel Anguilla marmorata in Thua Thien Hue, Vietnam base on COI sequences

Multiple population structure of the giant eel Anguilla marmorata in Thua Thien Hue, Vietnam base on COI sequences

Contact Info

Product

Resources

About