Pigment-cell-specific genes from fibroblasts are transactivated after chromosomal transfer into melanoma cells.

Abstract

Human and mouse fibroblast chromosomes carrying tyrosinase or b-locus genes were introduced, by microcell hybridization, into pigmented Syrian hamster melanoma cells, and the microcell hybrids were tested for transactivation of the fibroblast tyrosinase and b-locus genes. By using species-specific PCR amplification to distinguish fibroblast and melanoma cDNAs, it was demonstrated that the previously silent fibroblast tyrosinase and b-locus genes were transactivated following chromosomal transfer into pigmented melanoma cells. However, transactivation of the mouse fibroblast tyrosinase gene was unstable in microcell hybrid subclones and possibly dependent on a second fibroblast locus that could have segregated in the subclones. This second locus was not necessary for transactivation of the fibroblast b-locus gene, thus demonstrating noncoordinate transactivation of fibroblast tyrosinase and b-locus genes. Transactivation of the fibroblast tyrosinase gene in microcell hybrids apparently is dependent on the absence of a putative fibroblast extinguisher locus for tyrosinase gene expression, which presumably is responsible for the extinction of pigmentation in hybrids between karyotypically complete fibroblasts and melanoma cells.The generation of distinct cell types in multicellular animals only recently has begun to be understood at the genetic and molecular levels. Much emphasis has been placed on factors regulating transcription and on the DNA sequences interacting with such factors. However, the control mechanisms determining which regulatory factors will be active and when they will be expressed are still largely unknown, as are the mechanisms which maintain the differentiated state. Studies on the molecular control of pigment cell differentiation are still at an early stage, since pigment-cell-specific genes were cloned more recently than genes associated with a number of other tissue types.Pigmentation in mammals results from the synthesis of melanin in melanocytes of the skin, hairbulbs, and pigmented epithelium of the eye. Pigmentation is a complex biochemical and genetic process, with, in the mouse, over 50 distinct genetic loci involved (41). The synthesis of melanin in melanocytes requires the enzyme tyrosinase, encoded by the mouse albino (c) locus. In addition, other enzymes which regulate the type of melanin synthesized have recently been identified (for a review see reference 19). Another locus encoding an enzyme related to tyrosinase is the mouse brown (b) locus, which encodes a pigment-cell-specific catalase (18).Tyrosinase cDNAs from both mice (46) and humans (25) have been cloned and sequenced. The cDNA clones map to the albino (c) locus on mouse chromosome 7 (28) and to human chromosome 11 (q14-21) (2). Evidence that these clones encode the authentic tyrosinase enzyme and that mutations therein are the cause of albinism has been provided by (i) synthesis of an enzyme with tyrosinase activity upon transfection of the mouse cDNA clone and expression in cultured cells (28), (ii) identification of m...

Tumor Suppressor p53 Down‐Regulates Tissue‐Specific Expression of Tyrosinase Gene in Human Melanoma Cell Lines

“…Total cellular RNA was prepared from the cells by the guanidium isothiocyanate procedure, as previously performed (Rauth et al, 1990b;Rauth et al, 1993). Reverse transcription of total RNA was accomplished as described (Powers et al, 1994).…”

“…PCR amplification of reverse transcribed RNA was performed in a 100-1.11 volume with 2.5 U of Taq DNA polymerase (Promega) using an EriComp DNA thermocycler, as described by us (Rauth et al, 1994b). The sequences of the primers used to amplify tyrosinase cDNA sequences were obtained from published sequences (Powers et al, 1994) and were synthesized on an ABI model 394 DNA synthesizer. Primer 1: 5 ' TAGGACCTGCCAGTGCTCT 3 '; Primer 2: 5' AAGGCATTGTGCATGC 3'; Primer 3: 5' TGTCTGAGTTTGACCCAGTATGA 3 ' .…”

Inhibition of growth and induction of differentiation of metastatic melanoma cells in vitro by genistein: chemosensitivity is regulated by cellular p53

“…The sequences of the primers used to amplify tyrosinase cDNA sequences were: primer 1: 5'-TAGGACCTGCCAGTTGCCTTTCT-3' (sense); primer 2: 5'-AAGGCATTGTGCATGC-3' (antisense). The sequences of the primers were obtained from the published report (Powers et al, 1994) and were synthesized on an ABI model 394 DNA synthesizer. The primer 1 is located on exon 1, whereas primer 2 is located on exon 2 of the tyrosinase gene, and these primers amplify a 840-bp cDNA fragment.…”