Placental DAPK1 and autophagy marker LC3B-II are dysregulated by TNF-α in a gestational age-dependent manner

Abstract

Autophagy, a cell-survival process responsible for degradation of protein aggregates and damaged organelles, is increasingly recognized as another mechanism essential for human placentation. A substantial body of experiments suggests inflammation and oxidative stress as the underlying stimuli for altered placental autophagy, giving rise to placenta dysfunction and pregnancy pathologies. Here, the hypothesis is tested whether or not pro-inflammatory cytokines interleukin (IL)-6 and tumor necrosis factor (TNF)-α are able to influence the expression profile of autophagy genes in human first-trimester villous placenta. Autophagy-focused qPCR arrays identified substantial downregulation of death-associated protein kinase 1 (DAPK1) in first-trimester placental explants in response to IL-6 and TNF-α, respectively. Immunohistochemistry of placental explants detected considerable DAPK1 staining in placental macrophages, villous cytotrophoblasts and less intense in the syncytiotrophoblast. Both immunohistochemistry and Western blot showed decreased DAPK1 protein in TNF-α-treated placental explants compared to control. On cellular level, DAPK1 expression decreased in SGHPL-4 trophoblasts in response to TNF-α. Observed changes in the expression profile of autophagy-related genes were reflected by significantly decreased lipidation of autophagy marker microtubule-associated protein light chain 3 beta (LC3B-II) in first trimester placental explants in response to TNF-α. Analysis of TNF-α-treated term placental explants showed decreased DAPK1 protein, whereas in contrast to first-trimester LC3B expression and lipidation increased. Immunohistochemistry of placental tissues from early-onset preeclampsia (PE) showed less DAPK1 staining, when compared to controls. Accordingly, DAPK1 mRNA and protein were decreased in primary trophoblasts isolated from early-onset PE, while LC3B-I and -II were increased. Results from this study suggest that DAPK1, a regulator of apoptosis, autophagy and programmed necrosis, decreases in human placenta in response to elevated maternal TNF-α, irrespective of gestational age. In contrast, TNF-α differentially regulates levels of autophagy marker LC3B in human placenta over gestation.

Luteolin suppresses lipopolysaccharide‑induced cardiomyocyte hypertrophy and autophagy in�vitro

“…Previous studies have indicated that autophagy was closely associated with immune processes (46,47). In addition, autophagy can be assessed by some markers, such as LC3, Atg, Bnip1 and Vps34 (48–50). Among them, LC3 is a common autophagy-associated marker (33).…”

Abnormal CYP11A1 gene expression induces excessive autophagy, contributing to the pathogenesis of preeclampsia

“…Autophagy is thought to be involved in early human placentation [ 19 ]. A number of studies have reported that typical markers of autophagy, LC3 and P62 expression, are significantly increased in placentas from pregnancies complicated by PE and intrauterine growth restriction (IUGR) [ 20 ], suggesting that autophagy plays a key role in the pathogenesis of these diseases [ 10 , 21 ]. In this study, we have also confirmed increased expression of LC3 and P62 in placenta trophoblasts from PE and in BeWo cells overexpressing CYP11A1.…”

Downregulation of p53 drives autophagy during human trophoblast differentiation

“…Quality check was followed by reverse transcription of 1 µg total RNA per reaction using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) according to manufacturer’s manual. qPCR was performed with Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) using a Bio-Rad CFX96 cycler and specific primers for MAP1LC3B (MAP1LC3B_For: AAGGCGCTTACAGCTCAATG and MAP1LC3B_Rev: CTGGGAGGCATAGACCATGT) and TP53 (TP53_For: CAGCACATGACGGAGGTTGT and TP53_Rev: TCATCCAAATACTCCACACGC) as described previously [ 39 , 40 ]. Moreover, primers for GCM1 (GCM1_For: TTCCCGGTCACCAACTTCTG and GCM1_Rev: GTAAACTCCCCTGACTTTGTGTT), syncytin-1 (ERVW-1_For: CCATGCCGCTGTATGACCAG and ERVW-1_Rev: GGGTTCCCTTAGAAAGACTCCT), syncytin-2 (ERVFRD-1_For: ACCGCCATCCTGATTTCCC and ERVFRD-1_Rev: GAGGCTGGATAAGCTGTCCC), p62 (SQSTM1_For: GACTACGACTTGTGTAGCGTC and SQSTM1_Rev: AGTGTCCGTGTTTCACCTTCC) and hCG beta-subunit (CGB_For: TGAGCCACTCCTGCGCCC and CGB_Rev: CAGCCCCTGGAACATCTCCA) were used.…”