PLGA-PLL-Peg-Tf-Based Targeted Nanoparticles Drug Delivery System Enhance Antitumor Efficacy Via Intrinsic Apoptosis Pathway

Wen, Bo; Liu, Ran; Chen, Baoan; Wang, Fei; Zhang, Haijun; Xia, Guohua; Wu, Xue; Zhao, Kun; Li, Xiaoyü

doi:10.1182/blood.v126.23.5558.5558

Cited by 14 publications

(15 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Authors found that PLGA-PLL-PEG NPs are considered as an efficient drug delivery system, enhancing anti-cancer efficacy via intrinsic apoptosis pathway (Bao et al, 2015). The latter observation is in parallel with our results regarding AV and/or CR-loaded PEG-PLL NPs as promising anti-cancer platforms against lung A549 and liver Huh-7 cancerous cell lines via induction of early apoptosis through NO/MDA production and glycolytic inhibition.…”

Section: Discussionsupporting

confidence: 90%

“…It has been reported that PLL-modified poly (lactic-co-glycolic acid) (PLGA) NPs showed significantly higher entrapment efficiency (EE%) than PLGA NPs (Tahara et al, 2010). PLGA, when combined with PLL and PEG, has a relatively rapid rate of hydrolysis and it could reduce systemic clearance rates and prolong circulation half-life (Bao et al, 2015). Therefore, we selected PLL and PEG for encapsulating AV and CR to achieve bioavailable and biocompatible NPs.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Bevacizumab and CCR2 Inhibitor Nanoparticles Induce Cytotoxicity-Mediated Apoptosis in Doxorubicin-Treated Hepatic and Non-Small Lung Cancer Cells

Abdrabou

Ahmed

2019

Asian Pac J Cancer Prev

View full text Add to dashboard Cite

Non-small cell lung cancer (NSCLC) and hepatocellular carcinoma (HCC) are very common in certain population around the world. Despite the recent advances in their diagnosis and therapy, their prognosis remains poor due to the development resistance to drug. Although doxorubicin (DOX) is considered to be one of the most anti-solid tumor drugs, developed resistance is contributing to unsuccessful outcome. The rationale of the current study is to explore the sensitizing capability of the DOX-treated cancer cells using the anticancer agents; bevacizumab (avastin; AV) and CCR2 inhibitor (CR) in their free-and nano-formulations. Here, the average size, polydispersity index (PDI), zeta potential, and entrpment effeciency (EE%) of the synthesized nanoparticles were measured. We investigated the effect of these platforms on the proliferation, apoptosis, necrosis, nitric oxide (NO), malondialdehyde (MDA), and zinc levels of human HCC (HepG2 and Huh-7) and NSCLC (A549) cancer cell lines. Glucose consumption rates using Huh-7 and A549 cancer cells were tested upon treatments. We demonstrated that AV and CR nano-treatments significantly suppressed A549 cell viability and activated apoptosis by NO level elevation. We concluded that AVCR NP plus DOX significantly induces A549 cytotoxicity-mediated apoptosis more than Huh-7 and HepG2 cells. This drug-drug nano-combination induced Huh-7 cytotoxicity-mediated apoptosis more than HepG2 cells. In conclusion, AVCR NP sensitized DOX-treated A549 and Huh-7 cells through reactive oxygen species (ROS)-stimulated apoptosis. Taken together, our data suggested that the CR plus AV nano-platforms would be a potential personalized medicine-based strategy for treating CCR2-positive NSCLC and HCC patients in the near future.

show abstract

Section: Discussionsupporting

confidence: 90%

Section: Discussionmentioning

confidence: 99%

Bevacizumab and CCR2 Inhibitor Nanoparticles Induce Cytotoxicity-Mediated Apoptosis in Doxorubicin-Treated Hepatic and Non-Small Lung Cancer Cells

Abdrabou

Ahmed

2019

Asian Pac J Cancer Prev

View full text Add to dashboard Cite

show abstract

“…81 Zhang et al synthesized dual drug (DOX and combretastatin A4 (CA4)) loaded PLGA NPs with mono-and bi-layer lipid shells in a twostage HF microuidics. 82 Cellular uptake analysis with HeLa (cervical cancer cells) and HUVEC cells (Human umbilical vein endothelial cells) showed that NPs with monolayer lipid was taken up more than bilayer counterparts and even free drugs. Furthermore, similar ndings observed with in vivo and ex vivo analysis, i.e.…”

Section: Lipid-plga Npsmentioning

confidence: 99%

Microfluidic assisted synthesis of PLGA drug delivery systems

2019

View full text Add to dashboard Cite

show abstract

“…The same peptide is also produced by the marine bacterial strain PL26 of Bacillus licheniformis, isolated from the west coast of India [2]. Due to its well-known antimicrobial properties, ε-PLL is largely used worldwide as a food preservative [3,4], but is also used in many biomedical applications, including the enhancement of some anticancer agents [5], the suppression of the production of the prion protein in neurodegenerative disorders [6], the use in contrast agent probes for Magnetic Resonance Imaging [7] and the enhancement of gene delivery efficiency [8]. The industrial production of ε-PLL makes use of a mutant of Streptomyces albulus [9].…”

Section: Introductionmentioning

confidence: 99%

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

et al. 2020

View full text Add to dashboard Cite

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

show abstract

PLGA-PLL-Peg-Tf-Based Targeted Nanoparticles Drug Delivery System Enhance Antitumor Efficacy Via Intrinsic Apoptosis Pathway

Cited by 14 publications

References 32 publications

Bevacizumab and CCR2 Inhibitor Nanoparticles Induce Cytotoxicity-Mediated Apoptosis in Doxorubicin-Treated Hepatic and Non-Small Lung Cancer Cells

Bevacizumab and CCR2 Inhibitor Nanoparticles Induce Cytotoxicity-Mediated Apoptosis in Doxorubicin-Treated Hepatic and Non-Small Lung Cancer Cells

Microfluidic assisted synthesis of PLGA drug delivery systems

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

Contact Info

Product

Resources

About