Pre-mRNA splicing factor U2AF2 recognizes distinct conformations of nucleotide variants at the center of the pre-mRNA splice site signal

Glasser, Eliezra; Maji, Debanjana; Biancon, Giulia; Puthenpeedikakkal, Anees Mohammed Keedakkatt; Cavender, Chapin E.; Tebaldi, Toma; Jenkins, Jermaine L.; Mathews, David H.; Halene, Stephanie; Kielkopf, Clara L.

doi:10.1093/nar/gkac287

Cited by 17 publications

(10 citation statements)

References 67 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The associations between this editing and splicing event may be attributed to the co-regulations of RNA binding proteins, such as DHX9 , PRPF8 and U2AF2 . Their involvements in alternative splicing and RNA editing have been showed in previous studies (39,60,79,80). According to these analyses, we could further expand the functions of RNA editing QTLs from diverse aspects of phenotype changes.…”

Section: Resultssupporting

confidence: 62%

Genetic control of RNA editing in Neurodegenerative disease

Xue

Yang

et al. 2022

Preprint

View full text Add to dashboard Cite

A-to-I RNA editing diversifies human transcriptome to confer its functional effects on the downstream genes or regulations, potentially involving in neurodegenerative pathogenesis. Its variabilities are attributed to multiple regulators, including the key factor of genetic variant. To comprehensively investigate the potentials of neurodegenerative disease-susceptibility variants from the view of A-to-I RNA editing, we analyzed matched genetic and transcriptomic data of 1,596 samples across nine brain tissues and whole blood from two large consortiums, Accelerating Medicines Partnership - Alzheimer's Disease (AMP-AD) and Parkinson's Progression Markers Initiative (PPMI). The large-scale and genome-wide identification of 95,637 RNA editing quantitative trait loci revealed the preferred genetic effects on adjacent editing events. Furthermore, to explore the underlying mechanisms of the genetic controls of A-to-I RNA editing, several top RNA binding proteins were pointed out, such as EIF4A3, U2AF2, NOP58, FBL, NOP56, and DHX9, since their regulations on multiple RNA editing events probably interfered by these genetic variants. Moreover, these variants may also contribute to the variability of other molecular phenotypes associated with RNA editing, including the functions of four proteins, expressions of 148 genes, and splicing of 417 events. All the analyses results shown in NeuroEdQTL (https://relab.xidian.edu.cn/NeuroEdQTL/) constituted a unique resource for the understanding of neurodegenerative pathogenesis from genotypes to phenotypes related to A-to-I RNA editing.

show abstract

Section: Resultssupporting

confidence: 62%

Genetic control of RNA editing in Neurodegenerative disease

Xue

Yang

et al. 2022

Preprint

View full text Add to dashboard Cite

show abstract

“…Considering that FOXP3 introns have C-rich/U-poor py tracts and that these py tracts serve as poor substrates for U2AF2 binding (Sickmier et al, 2006;Glasser et al, 2022), it was not surprising that we observed significantly less U2AF2 binding to F3i11wt-tobra compared to F3i11pUtobra (Figure 3C). U2AF2 directly interacts with SF1, which binds the BPS, and U2AF1, which binds the 3'SS so it was also not surprising that we detected less binding of both proteins on F3i11wt-tobra compared to F3i11pU-tobra (Figure 3C).…”

Section: Discussionmentioning

confidence: 87%

Inefficient recruitment of DDX39B impedes pre-spliceosome assembly on FOXP3 introns

Nagasawa,

Bailey,

Russell

et al. 2024

RNA

View full text Add to dashboard Cite

Forkhead box P3 (FOXP3) is the master fate-determining transcription factor in regulatory T (Treg) cells and is essential for their development, function and homeostasis. Mutations in FOXP3 cause immunodysregulation polyendocrinopathy enteropathy X-linked (IPEX) syndrome, and aberrant expression of FOXP3 has been implicated in other diseases such as multiple sclerosis and cancer. We previously demonstrated that pre-mRNA splicing of FOXP3 RNAs is highly sen-sitive to levels of DExD-box polypeptide 39B (DDX39B) and here we investigate the mechanism of this sensitivity. FOXP3 introns have cytidine (C)-rich/uridine (U)-poor polypyrimidine (py) tracts that are responsible for their inefficient splicing and confer sensitivity to DDX39B. We show that there is a deficiency in the assembly of commitment complexes (CCs) on FOXP3 introns, which is consistent with the lower affinity of U2AF2 for C-rich/U-poor py tracts. Our data indicate an even stronger effect on the conversion of CCs to pre-spliceosomes. We propose that this is due to an altered conformation that U2AF2 adopts when it binds to C-rich/U-poor py tracts and that this conformation has a lower affinity for DDX39B. As a consequence, CCs assembled on FOXP3 introns are defective in recruiting DDX39B and this leads to inefficient assembly of pre-spliceosome complexes.

show abstract

“…The intronic variant c.866-34_866-8del is close to the 3′splice acceptor site of intron 8, and the pyrimidine content of the deleted sequence (CUUAUCUCCCUCUCUCUCUCUCUCUCC) is higher than 96%, which suggests that this sequence is likely to be located in the polypyrimidine tracts region in pre-mRNA. The absence of polypyrimidine tracts may interfere with the functioning of certain splicing factors and induce abnormal splicing ( Auweter and Allain, 2008 ; Glasser et al, 2022 ).…”

Section: Discussionmentioning

confidence: 99%

Four novel variants identified in primary hyperoxaluria and genotypic and phenotypic analysis in 21 Chinese patients

et al. 2023

View full text Add to dashboard Cite

Background: Primary hyperoxaluria (PH) is a rare genetic disorder characterized by excessive accumulation of oxalate in plasma and urine, resulting in various phenotypes due to allelic and clinical heterogeneity. This study aimed to analyze the genotype of 21 Chinese patients with primary hyperoxaluria (PH) and explore their correlations between genotype and phenotype.Methods: Combined with clinical phenotypic and genetic analysis, we identified 21 PH patients from highly suspected Chinese patients. The clinical, biochemical, and genetic data of the 21 patients were subsequently reviewed.Results: We reported 21 cases of PH in China, including 12 cases of PH1, 3 cases of PH2 and 6 cases of PH3, and identified 2 novel variants (c.632T > G and c.823_824del) in AGXT gene and 2 novel variants (c.258_272del and c.866-34_866-8del) in GRHPR gene, respectively. A possible PH3 hotspot variant c.769T > G was identified for the first time. In addition, patients with PH1 showed higher levels of creatinine and lower eGFR than those with PH2 and PH3. In PH1, patients with severe variants in both alleles had significantly higher creatinine and lower eGFR than other patients. Delayed diagnosis still existed in some late-onset patients. Of all cases, 6 had reached to end-stage kidney disease (ESKD) at diagnosis with systemic oxalosis. Five patients were on dialysis and three had undergone kidney or liver transplants. Notably, four patients showed a favorable therapeutic response to vitamin B6, and c.823_824dup and c.145A > C may be identified as potentially vitamin B6-sensitive genotypes.Conclusion: In brief, our study identified 4 novel variants and extended the variant spectrum of PH in the Chinese population. The clinical phenotype was characterized by large heterogeneity, which may be determined by genotype and a variety of other factors. We first reported two variants that may be sensitive to vitamin B6 therapy in Chinese population, providing valuable references for clinical treatment. In addition, early screening and prognosis of PH should be given more attention. We propose to establish a large-scale registration system for rare genetic diseases in China and call for more attention on rare kidney genetic diseases.

show abstract

Pre-mRNA splicing factor U2AF2 recognizes distinct conformations of nucleotide variants at the center of the pre-mRNA splice site signal

Cited by 17 publications

References 67 publications

Genetic control of RNA editing in Neurodegenerative disease

Genetic control of RNA editing in Neurodegenerative disease

Inefficient recruitment of DDX39B impedes pre-spliceosome assembly on FOXP3 introns

Four novel variants identified in primary hyperoxaluria and genotypic and phenotypic analysis in 21 Chinese patients

Contact Info

Product

Resources

About