Protective Effect of Avian Myelomonocytic Growth Factor in Infection with Marek’s Disease Virus

Abstract

Marek's disease virus (MDV) is a herpesvirus that induces T lymphomas in chickens.The aim of this study was to assess the role of the macrophage activator chicken myelomonocytic growth factor (cMGF) in controlling MDV infection. B13/B13 chickens, which are highly susceptible to MD, were either treated with cMGF delivered via a live fowlpox virus (fp/cMGF) or treated with the parent vector (fp/M3) or were left as untreated controls. Seven days later, when challenged with the very virulent RB-1B strain of MDV, the spleens of chickens treated with fp/cMGF showed increased expression of the inducible nitric oxide synthase (iNOS) gene compared to those of control chickens and fp/M3-treated chickens. Increased iNOS gene expression was also accompanied by greater induction of gamma interferon and macrophage inflammatory protein (K203) gene expression, both possible activators of iNOS. fp/cMGF treatment also increased the number of monocytes and systemic NO production in contrast to fp/M3 treatment. Even though cMGF treatment was unable to prevent death for the chickens, it did prolong their survival time, and viremia and tumor incidence were greatly reduced. In addition, cMGF treatment improved the partial protection induced by vaccination with HVT (herpesvirus isolated from turkeys) against RB-1B, preventing 100% mortality (versus 66% with vaccination alone) and greatly reducing tumor development. Treatment with fp/M3 did not have such effects. These results suggest that cMGF may play multiple roles in protection against MD. First, it may enhance the innate immune response by increasing the number and activity of monocytes and macrophages, resulting in increased NO production. Second, it may enhance the acquired immune response, indicated by its ability to enhance vaccine efficacy.

Cytokines as adjuvants for avian vaccines

“…Birds vaccinated with HVT alone suffered 33% mortality whereas vaccinated birds that were treated with cMGF had no mortality (Figure 4). These results showed improved protection with the vaccine and less tumour incidence in MDV‐challenged birds 52 , and clearly indicates the potential use of cMGF as a vaccine adjuvant for viral strains used in vaccines to increase protection against MDV.…”

“…The in vivo biological activity of cMGF delivered via a live fowlpox virus (fp/cMGF) had been demonstrated in a previous study 51 . A more recent study has indicated the adjuvant potential of cMGF 52 . Birds highly susceptible to Marek's disease virus (MDV) were treated with fp/cMGF.…”

Identification and Characterization of Thymosin β‐4 in Chicken Macrophages Using Whole Cell MALDI‐TOF

“…The conditions included denaturation at 94°C for 1 min, annealing at 60°C for 30 s, and extension at 72°C for 1 min using primers for Tβ‐4, IL‐6, and inducible nitric oxide synthase (iNOS) along with β‐actin as the reference gene 10 . The primers were designed with the Primer 3 software program 11 from the coding sequences of chicken Tβ‐4 (Genbank Accession NM 001001315 12 ), IL‐6 (Genbank accession AJ309540 13 ), and iNOS (Genbank accession U46504 14, 15 ). The primer sequences for Tβ‐4 were: forward: 5′ GCCGAGATCGAGAAATTTGA 3′; reverse: 5′ GAAGGCAATGCTTGTGGAAT 3′.…”

Marek’s Disease and Differential Diagnosis with Other Tumor Viral Diseases of Poultry

“…Combinations of HVT and glutaraldehyde-inactivated serotype 1 MDV obtained from feather follicles was reported to improve protection (Pruthi et al, 1987). Several studies have been conducted to include cytokines in MD vaccines to enhance the cellular immune response (Djeraba et al, 2002;Tarpey et al, 2007). The mechanisms involved are poorly understood and represent an overlooked but important area for future research.…”