Rapid engineering of bacterial artificial chromosomes using oligonucleotides

Swaminathan, Srividya; Ellis, Hilary; Waters, Laura S.; Yu, Daiguan; Lee, E-Chiang; Court, Donald L.; Sharan, Shyam K.

doi:10.1002/1526-968x(200101)29:1<14::aid-gene1001>3.0.co;2-x

Cited by 142 publications

(110 citation statements)

References 10 publications

(14 reference statements)

Supporting

Mentioning

108

Contrasting

Order By: Relevance

“…The Tyr423His point mutation (T to C in codon 423) was introduced into BAC DNA #16652 (Tomarev et al, 2003) using oligonucleotide-based recombining in Escherichia coli (Swaminathan et al, 2001;Court et al 2003). The targeting vector was generated using three primers: a 100-mer oligonucleotide with 50-base homology from either side of the region to be modified (SV-163), 5Ј-CATCCGTAAGCAGTCTGTG-GCCAATGCCTTTGTGCTCTGTGGCATCT-TGCACACGGTGAGCAGCTACTCTTCAG-CCCATGCAACCGTCAACTTTGCCTAC-3Ј; and two external primers: a forward (SV-164), 5Ј-TTGAGCGTACCTGGGAGACTAACATC-CGTAAGCAGTCTGTGG-3Ј, and a reverse (SV-165), 5Ј-CTGGTCCCCGTTTTAGT-GTCGTAGGCAAAGTTGACGGTTG-3Ј, each with 20-base overlaps on either side of SV-163.…”

Section: Methodsmentioning

confidence: 99%

Expression of Mutated Mouse Myocilin Induces Open-Angle Glaucoma in Transgenic Mice

Senatorov¹,

Malyukova²,

Fariss³

et al. 2006

J. Neurosci.

140

112

View full text Add to dashboard Cite

Section: Methodsmentioning

confidence: 99%

Expression of Mutated Mouse Myocilin Induces Open-Angle Glaucoma in Transgenic Mice

Senatorov¹,

Malyukova²,

Fariss³

et al. 2006

J. Neurosci.

140

112

View full text Add to dashboard Cite

“…These BACs were introduced into Escherichia coli stain DY380 in which the recombination genes exo, bet, and gam are under the control of the temperature-sensitive cI-repressor (Yu et al, 2000;Swaminathan et al, 2001). A deletion cassette containing Aspergillus fumigatus pyrG and zeocin resistance (ZEO) was amplified from plasmid pCDA21 (Chaveroche et al, 2000) by using primers TINApyr (5Ј-GAGGACATCACCTCGGTTTTAAAACTACATTAT-CTCAGGCTGCTTGCAGG//GAATTCGCCTCAAACAATGC) and TINAzeo (5Ј-GGGTATATGACGGTTTGACGCTACTTCATGCCC-AGTAACTCCCCCAGCTCA//GGAATTCTCAGTCCTGCTCC) with 50 base pairs of homology to the flanking regions of the tinA open reading frame.…”

Section: Deletion Of Tina By Using Bac Recombinationmentioning

confidence: 99%

“…A deletion cassette containing Aspergillus fumigatus pyrG and zeocin resistance (ZEO) was amplified from plasmid pCDA21 (Chaveroche et al, 2000) by using primers TINApyr (5Ј-GAGGACATCACCTCGGTTTTAAAACTACATTAT-CTCAGGCTGCTTGCAGG//GAATTCGCCTCAAACAATGC) and TINAzeo (5Ј-GGGTATATGACGGTTTGACGCTACTTCATGCCC-AGTAACTCCCCCAGCTCA//GGAATTCTCAGTCCTGCTCC) with 50 base pairs of homology to the flanking regions of the tinA open reading frame. The BAC containing DY380 strains were induced for recombination at 42°C and electroporated with the deletion cassette as described previously (Swaminathan et al, 2001). Correct deletion of tinA in the BAC clones was confirmed by PCR by using primers AO180 (5Ј CTTGGCCGTATAGATTCTGG) and AO190 (5Ј ACATCGGTGCTGTATTCCTC).…”

Section: Deletion Of Tina By Using Bac Recombinationmentioning

confidence: 99%

TINA Interacts with the NIMA Kinase inAspergillus nidulansand Negatively Regulates Astral Microtubules during Metaphase Arrest

Osmani

Davies

Oakley

et al. 2003

MBoC

View full text Add to dashboard Cite

The tinA gene of Aspergillus nidulans encodes a protein that interacts with the NIMA mitotic protein kinase in a cell cycle-specific manner. Highly similar proteins are encoded in Neurospora crassa and Aspergillus fumigatus. TINA and NIMA preferentially interact in interphase and larger forms of TINA are generated during mitosis. Localization studies indicate that TINA is specifically localized to the spindle pole bodies only during mitosis in a microtubule-dependent manner. Deletion of tinA alone is not lethal but displays synthetic lethality in combination with the anaphase-promoting complex/cyclosome mutation bimE7. At the bimE7 metaphase arrest point, lack of TINA enhanced the nucleation of bundles of cytoplasmic microtubules from the spindle pole bodies. These microtubules interacted to form spindles joined in series via astral microtubules as revealed by live cell imaging. Because TINA is modified and localizes to the spindle pole bodies at mitosis, and lack of TINA causes enhanced production of cytoplasmic microtubules at metaphase arrest, we suggest TINA is involved in negative regulation of the astral microtubule organizing capacity of the spindle pole bodies during metaphase. INTRODUCTIONMitosis is regulated by cell cycle-specific phosphorylation and regulated proteolysis of regulatory proteins mediated by activation and inactivation of cyclin-dependent kinases (CDKs) (O'Farrell, 2001) in all eukaryotes, including Aspergillus nidulans . In A. nidulans, mitosis is also regulated by a second kinase, NIMA (never in mitosis A), which when inactivated arrests cell in G 2 even though the CDK1 complex is active (Osmani et al., 1991a). Without activation of NIMA, active CDK1 is unable to accumulate in the nucleus but does so after mutation of the nuclear pore complex protein SONA rae1/gle2 (Wu et al., 1998). NIMA may therefore interact with the nuclear pore complex to help mediate localization of CDK1 at mitosis.NIMA is regulated at multiple levels, including mRNA abundance (Osmani et al., 1987), phosphorylation , and proteolysis Ye et al., 1998). NIMA has also been shown to have a dynamic localization during mitosis being sequentially located to DNA, the mitotic spindle, and the spindle pole body (SPB) (De Souza et al., 2000).Expression of NIMA promotes chromatin condensation (O'Connell et al., 1994) and transient formation of mitotic spindle-like structures (Osmani et al., 1988b). Stable versions of NIMA prevent normal exit from mitosis . The mitotic promoting activity of NIMA crosses species barriers from yeast to humans (Lu and Hunter, 1995a), indicating conserved NIMA substrates are involved in mitotic regulation.NIMA-related kinases have been isolated from Neurospora crassa and Schizosaccharomyces pombe (Krien et al., 1998), and the S. pombe NIMA-like kinase Fin1p is involved in mitotic regulation (Grallert and Hagan, 2002;Krien et al., 2002). NIMA-related kinases (NEKs) have also been identified in higher eukaryotes (Letwin et al., 1992;Schultz and Nigg, 1993;Lu and Hunter, 1995b;Chen et al., 1999;Tana...

show abstract

“…Gam inhibits the E. coli exonuclease RecBCD (Unger et al, 1972) allowing intracellular preservation of linear ds DNA, such as PCR products. Both dsDNA (Yu et al, 2000;Lee et al, 2001;Murphy, 1998) and ssDNA (Swaminathan et al, 2001;Ellis et al, 2001) substrates can be used in recombineering; insertion of dsDNA requires all three Plasmids are widely used, and thus, it is important to thoroughly characterize plasmid engineering mediated by recombineering. Recombineering of multicopy plasmids has complexities not associated with single copy replicons such as the bacterial chromosome, BACs, or PACs.…”

Section: Introductionmentioning

confidence: 99%

Multicopy plasmid modification with phage λ Red recombineering

Thomason¹,

Costantino²,

Shaw³

et al. 2007

Plasmid

Self Cite

View full text Add to dashboard Cite

Recombineering, in vivo genetic engineering using the bacteriophage λ Red generalized recombination system, was used to create various modifications of a multicopy plasmid derived from pBR322. All genetic modifications possible on the E. coli chromosome and on bacterial artificial chromosomes (BACs) are also possible on multicopy plasmids and are obtained with similar frequencies to their chromosomal counterparts, including creation of point mutations (5-10% unselected frequency), deletions and substitutions. Parental and recombinant plasmids are nearly always present as a mixture following recombination, and circular multimeric plasmid molecules are often generated during the recombineering. Keywordsphage λ Red homologous recombination; multicopy plasmid; plasmid multimers; in vivo genetic engineering

show abstract

Rapid engineering of bacterial artificial chromosomes using oligonucleotides

Cited by 142 publications

References 10 publications

Expression of Mutated Mouse Myocilin Induces Open-Angle Glaucoma in Transgenic Mice

Expression of Mutated Mouse Myocilin Induces Open-Angle Glaucoma in Transgenic Mice

TINA Interacts with the NIMA Kinase inAspergillus nidulansand Negatively Regulates Astral Microtubules during Metaphase Arrest

Multicopy plasmid modification with phage λ Red recombineering

Contact Info

Product

Resources

About