Real-time PCR detection and quantification of<i>Fusarium poae, F. graminearum, F. sporotrichioides</i>and<i>F. langsethiae</i>in cereal grains in Finland and Russia

Yli-Mattila, Tapani; Paavanen-Huhtala, Sari; Jestoi, Marika; Parikka, Päivi; Hietaniemi, Veli; Gagkaeva, Tatiana; Sarlin, Tuija; Haikara, Auli; Laaksonen, Sanna; Rizzo, A.

doi:10.1080/03235400600680659

Cited by 121 publications

(94 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…A common method for detect-ing and quantifying Fusarium in field samples is real-time PCR using species-specific primers (28). Multiplex real-time PCR has been used for the simultaneous detection of multiple Fusarium species (29,30), but detection is still limited to a few species. Description of Fusarium diversity without targeting specific species is traditionally performed by isolation on selective media, and identification is based on morphological and/or molecular characteristics, but this is a time-consuming procedure (27,31).…”

mentioning

confidence: 99%

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Karlsson

Edel-Hermann

Gautheron

et al. 2016

Appl Environ Microbiol

View full text Add to dashboard Cite

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genusspecific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa؉7/Ra؉6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa؉7/Ra؉6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology.

show abstract

mentioning

confidence: 99%

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Karlsson

Edel-Hermann

Gautheron

et al. 2016

Appl Environ Microbiol

View full text Add to dashboard Cite

show abstract

“…In the present study we focused on F. poae as one of the most frequently isolated FHB pathogens (Xu et al, 2005;Mankevičienė et al, 2007;Yli-Mattila et al, 2008;Stenglein, 2009;Sakalauskas et al, 2014). Previously we have determined that the other supposedly major wheat pathogens F. culmorum / F. cerealis play an insignificant role in production of DON and are not a producer of NIV in wheat (Suproniene et al, 2016).…”

Section: Discussionmentioning

confidence: 99%

Distribution of B type trichothecene producing Fusarium species in wheat grain and relation to mycotoxins DON and NIV concentrations

Supronienė

Sakalauskas

Mankevičienè

et al. 2016

Zemdirbyste-Agriculture

View full text Add to dashboard Cite

Fusarium head blight (FHB) is one of the most important cereal diseases causing yield losses and reducing its quality. B type trichothecenes (TRI) deoxynivalenol (DON) and nivalenol (NIV) are the main mycotoxins associated with FHB of wheat and other small-grain cereals. Usually, a particular Fusarium strain is able to produce only one type of B trichothecene. The detection of gene for NIV, DON and its acetylated derivatives 3-acetyldeoxynivalenol (3ADON) or 15-acetyldeoxynivalenol (15ADON) production is used for detection of FHB pathogens in plant material and their chemotyping. The current study presents the distribution of DON and NIV mycotoxins and their potential producers in Lithuanian wheat grain grown in 2013 and 2014. Grain samples of spring wheat (114) and winter wheat (30) were collected from 49 farms situated in 12 administrative districts of Lithuania. Fusarium species were identified and quantified by the morphological and quantitative polymerase chain reaction (qPCR) techniques. DON concentrations were estimated by the enzyme-linked immunosorbent assay (ELISA) in all collected grain samples and NIV using ultra performance liquid chromatography coupled with mass spectrometry (UPLC/MS) in 17 arbitrarily selected samples. F. graminearum, F. culmorum and F. poae were identified as species capable of producing mycotoxins DON and NIV in wheat grain. The highest DON quantities were identified in the grain of spring wheat grown in 2013 and this was clearly linked to F. graminearum DNA quantities (r = 0.783, p < 0.01). F. poae stood out as a potential NIV producer in the grain of Lithuania-grown wheat, since a positive correlation (r = 0.62, p < 0.01) between the quantities of F. poae DNA and NIV concentrations was established. F. culmorum was detected in unexpectedly small quantities in wheat grain and was found to be the potential producer of DON, but not NIV.

show abstract

“…Содержание в зерне ДНК группы грибов TriFusarium оценивали с помощью праймеров TMTri,f (CAGCAGMTRCTCAAGGTAGACCC), TMTri,r (AACTGTAYACRACCATGCCAAC) и флуоресцентной пробы (Cy5-AGCTTGGTGTTGGGATCTGTCCTTACCG-BHQ2) [16,17]. Содержание в зерне ДНК гри-ба F. poae оценивали с помощью праймеров TMpoae,f (GCTGAGGGTAAGCCGTCCTT) и TMpoae,r (TCTGTCCCCCCTACCAAGCT) и флуоресцентной про бы (TET-ATTTCCCCAACTTCGACTCTCCGAGGA-BHQ1) [18].…”

Section: методыunclassified

Diversity of the species of genus Avena revealed by morphological characters and resistance to Fusarium infection of grain

Gagkaeva

Юрьевна²,

Gavrilova

et al. 2017

Ecological genetics

View full text Add to dashboard Cite

Sixty six genotypes belong to wild and cultivated Avena species from the VIR collection were evaluated for infection of grain by Fusarium fungi and mycotoxins in accumulation. Among genotypes 13.6, 28.8, and 57.6% were diploid, tetraploid, and hexaploid oats, respectively. The aim of this study was to recognize the interrelationship between the wild species of the genus Avena not subjected to formal breeding programs, and Fusarium fungi, which have been reported as predominant seed borne pathogens. The real-time PCR was used to simultaneously detect and quantify fungi in grain of Avena genotypes. Mycotoxin analysis was performed by ELISA. The average amount of Fusarium DNA and deoxynivalenol (DON) in groups of the tetraploid oats were higher than they were found in the groups of di- and hexaploid species. It was determining the strong correlation between the presence of Tri-Fusarium DNA and DON content (p < 0,01). The low amounts of DON in the grain were detected in seven hexaploid genotypes (A. byzantina, A. sterilis, A. sativa, and A. fatua) and one diploid A. wiestii. The connection of morphological characters (weight of 1000 grains, husk hardness, trichomes profusion and plant height) of Avena species and the indicators of Fusarium infection were analyzed. Only biomass of Fusarium has demonstrated significant connection with weight of 1000 grains. Significant correlation between the hardness of husk and the amounts of Fusarium DNA (p < 0,01) was detected. For Fusarium the strong protective effect of the husk from the penetration of pathogens into grain was evident.

show abstract

Real-time PCR detection and quantification ofFusarium poae, F. graminearum, F. sporotrichioidesandF. langsethiaein cereal grains in Finland and Russia

Cited by 121 publications

References 38 publications

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

Distribution of B type trichothecene producing Fusarium species in wheat grain and relation to mycotoxins DON and NIV concentrations

Diversity of the species of genus Avena revealed by morphological characters and resistance to Fusarium infection of grain

Contact Info

Product

Resources

About