Regulation of growth hormone (GH) receptor (GHR1 and GHR2) mRNA level by GH and metabolic hormones in primary cultured tilapia hepatocytes

Pierce, Andrew L.; Breves, Jason P.; Moriyama, Shunsuke; Uchida, Katsuhisa; Grau, E. Gordon

doi:10.1016/j.ygcen.2012.07.010

Cited by 31 publications

(24 citation statements)

References 62 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…First, we observed a clear induction of hepatic ghr2 mRNA in hypophysectomized animals following Gh treatment Fig. 4C), a pattern consistent with the proposition that ghr2 encodes the primary Gh receptor in tilapia (Kajimura et al, 2004; Pierce et al, 2007; Pierce et al, 2012). As reported previously (Chen et al, 2007), plasma Igf1 increased following oGh injection Fig.…”

Section: Discussionsupporting

confidence: 86%

“…Relative mRNA expression was determined by qRT-PCR using the StepOnePlus real-time PCR system (Life Technologies, Carlsbad, CA). Primer pairs for ghr1, ghr2, igf1, igf2 and ef1 αare previously described (Pierce et al, 2007; Breves et al, 2011; Pierce et al, 2011; Pierce et al, 2012). Additional primer pairs used were (5'-3'): igfbp1b (forward, CCTTCCCTTTGATCACCAAG; reverse, GTGTGACATGGACCCTGTTG; amplicon size = 102 nt), igfbp2b (forward, CCGACTTCCCTTTACAGCAG; reverse, TCAGTCCCATGCACCTCATA; amplicon size = 112 nt), igfbp4 (forward, ATCCCCATACCCAACTGTGA; reverse, TGATCCACACACCAGCATTT; amplicon size = 98 nt), igfbp5a (forward, AACTGGACGGGATCATTCAG; reverse, GCACTGTTTGCGTTTGAAGA; amplicon size = 107 nt), and igfbp6b (forward, TCCTACCTGCAGAGGAAAGC; reverse, CGCAGCTCAGAGTGTAGACG; amplicon size = 104 nt).…”

Section: Methodsmentioning

confidence: 99%

“…Phylogenetic analyses, tissue expression patterns, and regulation by Gh of these two ghrs suggest that ghr2 encodes the primary Gh receptor (Kajimura et al, 2004; Pierce et al, 2007; Pierce et al, 2012). Further evidence of divergent physiological roles for these two receptors comes from observations that ghr1 and ghr2 transcript expression is differentially responsive to fasting (Saera-Vila et al, 2005; Uchida et al, 2009; Fox et al, 2010), temperature (Gabillard et al, 2006), stressors (Saera-Vila et al, 2009), metabolic hormones (Reindl et al, 2009; Pierce et al, 2012), xenobiotics (Davis et al, 2009), and salinity (Pierce et al, 2007; Breves et al, 2011). Dynamic ghr expression within key metabolic tissues following alterations in nutritional, osmoregulatory and endocrine states occurs across teleosts (Reinecke, 2010; Reindl and Sheridan, 2012).…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Nutritional status and growth hormone regulate insulin-like growth factor binding protein (igfbp) transcripts in Mozambique tilapia

Breves

Tipsmark

Stough

et al. 2014

General and Comparative Endocrinology

View full text Add to dashboard Cite

Growth in teleosts is controlled in large part by the activities of the growth hormone (Gh)/insulin-like growth factor (Igf) system. In this study, we initially identified igf-binding protein (bp)1b, -2b, -4, -5a and -6b transcripts in a tilapia EST library. In Mozambique tilapia (Oreochromis mossambicus), tissue expression profiling of igfbps revealed that igfbp1b and -2b had the highest levels of expression in liver while igfbp4, -5a and -6b were expressed at comparable levels in most other tissues. We compared changes in hepatic igfbp1b, -2b and -5a expression during catabolic conditions (28 days of fasting) along with key components of the Gh/Igf system, including plasma Gh and Igf1 and hepatic gh receptor (ghr2), igf1 and igf2 expression. In parallel with elevated plasma Gh and decreased Igf1 levels, we found that hepatic igfbp1b increased substantially in fasted animals. We then tested whether systemic Gh could direct the expression of igfbps in liver. A single intraperitoneal injection of ovine Gh into hypophysectomized tilapia specifically stimulated liver igfbp2b expression along with plasma Igf1 and hepatic ghr2 levels. Our collective data suggest that hepatic endocrine signaling during fasting may involve post-translational regulation of plasma Igf1 via a shift towards the expression of igfbp1b. Thus, Igfbp1b may operate as a molecular switch to restrict Igf1 signaling in tilapia; furthermore, we provide new details regarding isoform-specific regulation of igfbp expression by Gh.

show abstract

Section: Discussionsupporting

confidence: 86%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Nutritional status and growth hormone regulate insulin-like growth factor binding protein (igfbp) transcripts in Mozambique tilapia

Breves

Tipsmark

Stough

et al. 2014

General and Comparative Endocrinology

View full text Add to dashboard Cite

show abstract

“…Consistent with previous observations in salmonids (Pierce et al 2005, Reindl & Sheridan 2012 and tilapia (Oreochromis mossambicus; Pierce et al 2012) cortisol upregulated the expression of hepatic ghr2 in this study. Chronic cortisol exposure also elicited dosedependent increases in hepatic igf1 expression that closely matched the increase in ghr2 mRNA levels, results which suggest an increase in hepatic GH sensitivity.…”

Section: Discussionsupporting

confidence: 93%

Chronic cortisol and the regulation of food intake and the endocrine growth axis in rainbow trout

Madison

Tavakoli

Krämer

et al. 2015

Journal of Endocrinology

View full text Add to dashboard Cite

To gain a better understanding of the mechanisms by which cortisol suppresses growth during chronic stress in fish, we characterized the effects of chronic cortisol on food intake, mass gain, the expression of appetite-regulating factors, and the activity of the GH/IGF axis. Fish given osmotic pumps that maintained plasma cortisol levels at w70 or 116 ng/ml for 34 days were sampled 14, 28 and 42 days post-implantation. Relative to shams, the cortisol treatments reduced food intake by 40-60% and elicited marked increases in liver leptin (lep-a1) and brain preoptic area (POA) corticotropin-releasing factor (crf) mRNA levels. The cortisol treatments also elicited 40-80% reductions in mass gain associated with increases in pituitary gh, liver gh receptor (ghr), liver igfI and igf binding protein (igfbp)-1 and -2 mRNA levels, reduced plasma GH and no change in plasma IGF1. During recovery, while plasma GH and pituitary gh, liver ghr and igfI gene expression did not differ between treatments, the high cortisol-treated fish had lower plasma IGF1 and elevated liver igfbp1 mRNA levels. Finally, the cortisol-treated fish had higher plasma glucose levels, reduced liver glycogen and lipid reserves, and muscle lipid content. Thus, our findings suggest that the growth-suppressing effects of chronic cortisol in rainbow trout result from reduced food intake mediated at least in part by increases in liver lep-a1 and POA crf mRNA, from sustained increases in hepatic igfbp1 expression that reduce the growth-promoting actions of the GH/IGF axis, and from a mobilization of energy reserves.

show abstract

“…We did not observe any effect of LPS on SOCS modulation in trout liver leading to the proposal that LPS effect on GH action occurs upstream of STAT5 modulation. Recent studies have described the co-existence of two clades of putative receptors for GH (GHR1 and GHR2) in fishes, both of which are highly expressed in the liver [46, 47]. However, functional differences between GHR1 and GHR2 are not clear.…”

Section: Discussionmentioning

confidence: 99%

Stress-Immune-Growth Interactions: Cortisol Modulates Suppressors of Cytokine Signaling and JAK/STAT Pathway in Rainbow Trout Liver

Philip

Vijayan

2015

PLoS ONE

View full text Add to dashboard Cite

Chronic stress is a major factor in the poor growth and immune performance of salmonids in aquaculture. However, the molecular mechanisms linking stress effects to growth and immune dysfunction is poorly understood. The suppressors of cytokine signaling (SOCS), a family of genes involved in the inhibition of JAK/STAT pathway, negatively regulates growth hormone and cytokine signaling, but their role in fish is unclear. Here we tested the hypothesis that cortisol modulation of SOCS gene expression is a key molecular mechanism leading to growth and immune suppression in response to stress in fish. Exposure of rainbow trout (Oncorhynchus mykiss) liver slices to cortisol, mimicking stress level, upregulated SOCS-1 and SOCS-2 mRNA abundance and this response was abolished by the glucocorticoid receptor antagonist mifepristone. Bioinformatics analysis confirmed the presence of putative glucocorticoid response elements in rainbow trout SOCS-1 and SOCS-2 promoters. Prior cortisol treatment suppressed acute growth hormone (GH)-stimulated IGF-1 mRNA abundance in trout liver and this involved a reduction in STAT5 phosphorylation and lower total JAK2 protein expression. Prior cortisol treatment also suppressed lipopolysaccharide (LPS)-induced IL-6 but not IL-8 transcript levels; the former but not the latter cytokine expression is via JAK/STAT phosphorylation. LPS treatment reduced GH signaling, but this was associated with the downregulation of GH receptors and not due to the upregulation of SOCS transcript levels by this endotoxin. Collectively, our results suggest that upregulation of SOCS-1 and SOCS-2 transcript levels by cortisol, and the associated reduction in JAK/STAT signaling pathway, may be a novel mechanism leading to growth reduction and immune suppression during stress in trout.

show abstract

Regulation of growth hormone (GH) receptor (GHR1 and GHR2) mRNA level by GH and metabolic hormones in primary cultured tilapia hepatocytes

Cited by 31 publications

References 62 publications

Nutritional status and growth hormone regulate insulin-like growth factor binding protein (igfbp) transcripts in Mozambique tilapia

Nutritional status and growth hormone regulate insulin-like growth factor binding protein (igfbp) transcripts in Mozambique tilapia

Chronic cortisol and the regulation of food intake and the endocrine growth axis in rainbow trout

Stress-Immune-Growth Interactions: Cortisol Modulates Suppressors of Cytokine Signaling and JAK/STAT Pathway in Rainbow Trout Liver

Contact Info

Product

Resources

About