Research Article Novel multiplex PCR for detection of diarrheagenic Escherichia coli strains isolated from stool and water samples.

Abstract

ABSTRACT. Diarrhea is considered the second most common cause of infant mortality worldwide. The disease can be caused by many different pathogens, including diarrheagenic Escherichia coli (DEC), which includes the pathotypes enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), Shiga toxin-producing E. coli (STEC), and enteropathogenic E. coli (EPEC). To develop a multiplex PCR system for the safe and accurate identification of the five main pathotypes of DEC, seven pairs of primers were determined for the following genes: aaiC, escV, bfpA, ipaH, elt, stx1, and stx2. To validate the system, 413 isolates from different sources (water and both animal and human stool) were analyzed that had been characterized previously. The sensitivity data were grouped by pathotype, in which 92.7% of the atypical EPEC were correlated, as were 92.8% of the STEC, 91.35% of the EAEC, and 100% of the typical EPEC, ETEC, and EIEC. These findings indicate that it is possible to detect the major five pathotypes of DEC from different sources, which can aid in determining the epidemiology of diarrhea with a low cost, high sensitivity and specificity, and the easy and safe viewing of the resulting PCR products.

Occurrence of virulent and antibiotic resistant Staphylococcus species in ready-to-eat Rhynchophorus phoenicis and Archachatina marginata vended along the Port Harcourt-Bayelsa route

“…The extraction of DNA was by boiling method described by Eruteya et al (2014) and Vendruscolo et al (2017). For DNA extraction, aliquot of 0.5 mL of 5 mL overnight Luria Bertani (LB) broth culture of bacterial isolates was transferred to 2 mL Eppendorf tubes.…”

Defining a Molecular Signature for Uropathogenic versus Urocolonizing Escherichia coli: The Status of the Field and New Clinical Opportunities

“…In particular, syndromic molecular testing has grown in clinical popularity, in which multiplex PCR assays are used to identify at once a number of causative pathogens within stool (and other specimen types), including multiple enteric pathotypes of E. coli [40]. Commercially available assays now exist that identify, for instance, Shiga-toxin producing E. coli (STEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli/Shigella (EIEC), enteropathogenic E. coli (EPEC), and enteroaggregative E. coli [38,[61][62][63][64]. However, diagnostic financial considerations aside, a molecular assay for identifying UPEC UTIs would be hampered physiologically and genetically by the prevalence of ASB and our inability to differentiate ASB and UTI strains.…”

Caracterização de Escherichia coli diarreiogênica isolada de água subterrânea para consumo humano em um assentamento rural

“…Tabela 1 -Sequência dos oligonucleotídeos pesquisados e tamanho dos fragmentos de DNA amplificados. Vendruscolo et al (9) eae (F) GACCCGGCACAAGCATAAGC (R) CCACCTGCAGCAACAAGAGG…”