Residual factor VII activity and different hemorrhagic phenotypes in CRM+ factor VII deficiencies (Gly331Ser and Gly283Ser)

Pinotti, Mirko; Etro, Daniela; Bindini, Debora; Papa, M. L.; Rodorigo, G.; Rocino, Angiola; Mariani, Guglielmo; Ciavarella, N.; Bernardi, Francesco

doi:10.1182/blood.v99.4.1495

Cited by 24 publications

(28 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Functional assays were conducted in plasma systems with human TF (Innovin) and by exploiting the FXa fluorogenic substrate to better mimic physiological conditions and to guarantee high sensitivity to very low activity levels. 6,13 Compared to the activity (9.5±1.8 Rfu/sec/nM FVII) of a similar concentration of rFVII-wt, that of the rFVII-462X appeared to be approximately four times higher (36.3±8 Rfu/sec/nM FVII; 382%) ( Figure 2B and C). Overlapping results were obtained with RecombPlasTin 2G (440%) and bovine thromboplastin (400%), whereas there was no appreciable activity with rabbit thromboplastin.…”

Section: Resultsmentioning

confidence: 99%

“…The mutations (underlined) were introduced into the human FVII cDNA cloned into the pCDNA3 vector 13 by using the QuickChange® II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) and the following forward primers:…”

Section: Expression Vectors Cell Culture and Transfectionmentioning

confidence: 99%

“…13 The recombinant FVII (rFVII) in media were concentrated through the Amicon Ultra centrifugal filter devices (cut-off 30 KDa, Millipore, Carrigtwohill, Country Cork, Ireland).…”

Section: Expression Vectors Cell Culture and Transfectionmentioning

confidence: 99%

See 2 more Smart Citations

Natural and engineered carboxy-terminal variants: decreased secretion and gain-of-function result in asymptomatic coagulation factor VII deficiency

Branchini¹,

Rizzotto²,

Mariani³

et al. 2011

Haematologica

View full text Add to dashboard Cite

Articles and Brief Reportshaematologica | 2012; 97 (5) 705 IntroductionThe congenital deficiency of coagulation factor VII (FVII) (OMIM: 227500) is a rare hemorrhagic disorder with an autosomal recessive inheritance pattern.1 Clarification of the relationship between FVII coagulant activity levels in plasma and bleeding diathesis is greatly helped by our understanding of the molecular mechanisms through which F7 gene mutations 2-3 modulate FVII levels. Nonsense mutations, by inducing mRNA degradation 4 and/or premature termination of translation and synthesis of truncated proteins, are often responsible for very severe forms of human diseases. As expected from the crucial role of FVII in coagulation, 5 very few homozygous patients present this type of mutation and these are associated with undetectable FVII levels and severe 6-8 or moderate 9 bleeding. Coagulation serine proteases share extensive homology 10 but are highly variable in their carboxy-terminal region, the functional role of which has still not been established.In this study, we characterized the p.R462X nonsense mutation and provided evidence for its pleiotropic effects, i.e. reduced secretion and increased specific activity, thus explaining the asymptomatic phenotype in patients. Furthermore, a panel of recombinant carboxy-terminal variants contributed to our understanding of the role of this highly variable region in coagulation serine proteases. Design and Methods PatientsThe proposita (PFVII-R462X) is a 12-year old girl who had been diagnosed for FVII deficiency during a routine coagulation screening. The patient presented with a prolonged prothrombin time (8%) and decreased FVII coagulant activity (3 and 5% of normal in 2 samples taken one year apart); all other coagulation factors functioned normally. She had no history of any bleeding and continues to be asymptomatic. F7 gene sequencing 11 identified the c.1384C>T transition (GenBank #NM_000131.3) in a homozygous condition. This Natural and engineered carboxy-terminal variants: decreased secretion and gain-of-function result in asymptomatic coagulation factor VII deficiency 74 -44121 Ferrara, Italy. Phone: international +39.0532974424. Fax: international +39.0532974484. E-mail: pnm@unife.it We report 2 asymptomatic homozygotes for the nonsense p.R462X mutation affecting the carboxy-terminus of coagulation factor VII (FVII, 466 aminoacids). FVII levels of 3-5% and 2.7±0.4% were found in prothrombin time-based and activated factor X (FXa) generation assays with human thromboplastins. Noticeably, FVII antigen levels were barely detectable (0.7±0.2%) which suggested a gain-of-function effect. This effect was more pronounced with bovine thromboplastin (4.8±0.9%) and disappeared with rabbit thromboplastin (0.7±0.2%). This suggests that the mutation influences tissue factor/FVII interactions. Whereas the recombinant rFVII-462X variant confirmed an increase in specific activity (~400%), a panel of nonsense (p.P466X, p.F465X, p.P464X, p.A463X) and missense (p.R462A, p.R462Q, p.R462W) mutations o...

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Expression Vectors Cell Culture and Transfectionmentioning

confidence: 99%

See 1 more Smart Citation

Natural and engineered carboxy-terminal variants: decreased secretion and gain-of-function result in asymptomatic coagulation factor VII deficiency

Branchini¹,

Rizzotto²,

Mariani³

et al. 2011

Haematologica

View full text Add to dashboard Cite

show abstract

“…Expression vectors for the secreted human FVII 21 and for the parental (pU1-wt) and mutated (pU1ϩ5a) human U1-snRNA 11 were available in the laboratory.…”

Section: Creation Of Vectorsmentioning

confidence: 99%

“…Transfection and studies at the mRNA and protein level COS-1 (African green monkey kidney fibroblasts) cells were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) into 30-mm plates 11,21 with 3 g of each FVII expression vector and, in complementation assays, with 1ϫ, 1.5ϫ, 2ϫ, and 2.5ϫ molar excess of pU1-snRNA vectors. Culture medium (OptiMEM; Invitrogen) was supplemented with 5 g/mL vitamin K (Konakion; Roche, Welwyn Garden City, United Kingdom) to allow proper FVII biosynthesis.…”

Section: Creation Of Vectorsmentioning

confidence: 99%

Rescue of coagulation factor VII function by the U1+5A snRNA

Pinotti¹,

Balestra²,

Rizzotto³

et al. 2009

Blood

Self Cite

View full text Add to dashboard Cite

Our previous studies with genomic minigenes have demonstrated that an engineered small nuclear RNA-U1 (U1؉5a) partially rescued coagulation factor VII (FVII) mRNA processing impaired by the 9726؉5G>A mutation. Here, to evaluate the U1؉5a effects on FVII function, we devised a full-length FVII splicingcompetent construct (pSCFVII-wt). This construct drove in COS-1 cells the synthesis of properly processed FVII transcripts and of secreted functional FVII (23 ؎ 4 ng/ mL), which were virtually undetectable upon introduction of the 9726؉5G>A mutation (pSCFVII-9726؉5a). Cotransfection of pSCFVII-9726؉5a with pU1؉5a resulted in a partial rescue of FVII splicing and protein biosynthesis. The level increase in medium was dose dependent and, with a molar excess (1.5؋) of pU1؉5a, reached 9.5% plus or minus 3.2% (5.0 ؎ 2.8 ng/mL) of FVII-wt coagulant activity. These data provide the first insights into the U1-snRNA-mediated rescue of donor splice sites at protein level, thus further highlighting its therapeutic implications in bleeding disorders, which would benefit even from tiny increase of functional levels. (Blood. 2009;113: 6461-6464) IntroductionThe elucidation of molecular mechanisms underlying aberrant mRNA processing, a frequent cause of all inherited human disorders, 1-2 has provided the rationale for RNA-based correction strategies that offer several advantages over the gene replacement therapy methods, including maintenance of the proper transcriptional control of the disease gene.The vast majority of RNA-based approaches have exploited, in vitro and in vivo, antisense sequences to either mask natural splice sites, to induce skipping of defective exons, 3-5 or newly generated cryptic sites, 3,[6][7][8] to favor the use of the canonical ones. Only a few attempts [9][10][11][12] have been made to restore gene expression impaired by mutations at canonical donor splice sites (5'ss), which are the most frequent targets in human disease genes, 1 including coagulation factor genes. 13-18 Although we 10-12 and others 9 have partially restored correct splicing using the small nuclear RNA U1 (U1-snRNA), 19 the experimental settings did not allow the assessment of rescue at protein and function levels, the key issue for the evaluation of the therapeutic potential.Here, by exploiting a splicing-competent full-length construct, and thus a novel cellular model of severe coagulation factor VII (FVII) deficiency caused by the IVS7 9726ϩ5GϾA mutation, 20 we demonstrated that the U1-snRNA-mediated rescue of FVII mRNA processing eventually results in an appreciable secretion of functional FVII. Methods Creation of vectorsExpression vectors for the secreted human FVII 21 and for the parental (pU1-wt) and mutated (pU1ϩ5a) human U1-snRNA 11 were available in the laboratory.To create the full-length splicing-competent constructs, the FVII gene region spanning exons 6 through 8 (nt's 8926-11157) 22 from our previously prepared wild-type and mutated minigene constructs 11 was amplified with primers 5Ј GCATCTTTCTGACTTTTGTT 3Ј (forward) a...

show abstract

Congenital Bleeding: Autosomal Recessive Disorders

Peyvandi

Mannucci

2005

Postgraduate Haematology

View full text Add to dashboard Cite

Residual factor VII activity and different hemorrhagic phenotypes in CRM+ factor VII deficiencies (Gly331Ser and Gly283Ser)

Cited by 24 publications

References 23 publications

Natural and engineered carboxy-terminal variants: decreased secretion and gain-of-function result in asymptomatic coagulation factor VII deficiency

Natural and engineered carboxy-terminal variants: decreased secretion and gain-of-function result in asymptomatic coagulation factor VII deficiency

Rescue of coagulation factor VII function by the U1+5A snRNA

Congenital Bleeding: Autosomal Recessive Disorders

Contact Info

Product

Resources

About