Resistance of Plasmopara viticola to multiple fungicides in vineyards of Maharashtra, India

Abstract

aims to assess the fungicide resistance status of P. viticola for developing a future guideline for downy mildew management of grapes in India.One hundred and sixty downy mildew infected grape leaf samples were collected from 16 vineyards located in Maharashtra, India during September 2015 to November 2016. Most of these vineyards had heavy incidence of downy mildew disease, even though several fungicide interventions for its control were made. The fungicide sensitivity was assessed against kresoxim methyl, dimethomorph, Cymoxanil and Metaxyl-M using leaf disc bioassay, and QoI and CAA resistance gene was detected using allele specific multiplex PCR.Based on the sensitivity response in leaf disc bio-assay, isolates of P. viticola were categorized as, sensitive (S), intermediate (I) or highly resistant (R) to four fungicides. The percentage of sensitive P.

First report of quinone outside inhibitor (QoI) resistance in Plasmopara viticola (grape downy mildew) in Karnataka state in India

“…The EC 50 value ranged from 14.05 to 18.45 µg ml -1 in moderately resistant isolates with RF of 6.77-8.81 and resistant isolates ranged from 14.03 to 29.12 µg ml -1 with RF (25.23-52.36) while that of the highly resistant isolates ranged from 78.56 to 196.54 µg ml -1 with RF of 37.86-94.72. The resistance to QoI fungicides in P. viticola was developed due to the mutation in the cytochrome b (cyt b) gene at G143A site, this can be detected by polymerase chain reaction using allele-speci c primers GGGGTTTGTATTACGGATCT (Forward) and GGATATTTGAACCTACCTC (Backward) as described by Ghule et al (2020). Total DNA was isolated from all the isolates using MN kit as per the manufactures protocol (Macherey-Nagel, Germany) and the quality was assed using Qubit ® 3.0 uorometer (Thermo Fisher Scienti c) before being subjecting to thermocycler using allele-speci c primers.…”

Fungicide Resistance Evolution and Detection in Plant Pathogens: Plasmopara viticola as a Case Study

“…Resistance to different fungicide modes of action in P. viticola has been reported ( Table 1 ) in the main vine-growing areas ( Figure 2 ) using different detection techniques [ 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 ].…”

“… Global vine-growing areas allocated for the production of wine grapes, table grapes, or dried grapes in 2018 (sources Organisation of Vine and Wine and ood and Agriculture Organization of the United Nations) ( A ), compared to countries where P. viticola fungicide resistance was reported in 2020 ( B ) [ 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 ]. …”

Sensitivity of Plasmopara viticola to selected fungicide groups and the occurrence of the G143A mutant in Australian grapevine isolates

“…20 In 2020, 37.5% of 160 isolates collected from vineyards in India were reported to be resistant. 21 Despite multiple investigations into the mechanism of resistance to PAs, the resistance gene and mutation remains unknown. 12 Carboxylic acid amide (CAA, group 40) fungicides include dimethomorph, iprovalicarb, benthiavalicarb, valifenalate and mandipropamid.…”