Roman high and low avoidance rats differ in their response to chronic olanzapine treatment at the level of body weight regulation, glucose homeostasis, and cortico-mesolimbic gene expression

Abstract

Olanzapine, an antipsychotic agent mainly used for treating schizophrenia, is frequently associated with body weight gain and diabetes mellitus. Nonetheless, studies have shown that not every individual is equally susceptible to olanzapine's weight-gaining effect. Therefore, Roman high and low avoidance rat strains were examined on their responsiveness to olanzapine treatment. The Roman high avoidance rat shares many behavioral and physiological characteristics with human schizophrenia, such as increased central dopaminergic sensitivity, whereas the Roman low avoidance rat has been shown to be prone to diet-induced obesity and insulin resistance. The data revealed that only the Roman high avoidance rats are susceptible to olanzapine-induced weight gain and attenuated glucose tolerance. Here it is suggested that the specific olanzapine-induced weight gain in Roman high avoidance rats could be related to augmented dopaminergic sensitivity at baseline through increased expression of prefrontal cortex dopamine receptor D1 mRNA and nucleus accumbens dopamine receptor D2 mRNA expression. Regression analyses revealed that olanzapine-induced weight gain in the Roman high avoidance rat is above all related to increased prolactin levels, whereas changes in glucose homeostasis is best explained by differences in central dopaminergic receptor expressions between strains and treatment. Our data indicates that individual differences in dopaminergic receptor expression in the cortico-mesolimbic system are related to susceptibility to olanzapine-induced weight gain.

Individual housing of male C57BL/6J mice after weaning impairs growth and predisposes for obesity

“…Quantity and chemical purity of RNA and cDNA were assessed using Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). mRNA expression was measured using real time polymerase chain reaction (RT-PCR) according to a protocol previously described (63). The RT-PCR was performed in triplicates by using validated UCP-1 primers (forward primer CAAAAACAGAAGGATTGCCGAAA, reverse primer TCTTGGACTGAGTCGTAGAGG), with housekeeping gene RPL13A, SYBR green and the CFX96 qPCR (Bio-Rad, Veenendaal, Netherlands).…”

Effect of Metformin on Antipsychotic-Induced Metabolic Dysfunction: The Potential Role of Gut-Brain Axis

“…Compared to vehicle-treated rats, body weight, blood glucose, and dopaminergic receptor expression in the cortico-mesolimbic system were higher in the olanzapine-treated Roman high-avoidance rats; in contrast, the Roman low-avoidance rats showed no differences in these measures. The discrepancy was due to the Roman high-avoidance rats having elevated central dopaminergic sensitivity, which indicated that dopamine receptor expression is related to olanzapine-induced weight gain (Evers et al., 2017). The serotonin 2C receptor has been implicated in many neurological and biological processes, including the regulation of food intake, body weight, and glucose metabolism.…”

Influence of olanzapine on serum prolactin levels and BMI in female patients with schizophrenia

“…For example, a head-to-head meta-analysis reported that olanzapine causes the highest amount of weight gain 4. Additionally, there is ample evidence showing that it is likely that a complex biological mechanism is involved5 and that neuroendocrine alternation may play an important role in olanzapine-induced weight gain 6,7…”