Self‐Assembly of G‐Rich Oligonucleotides Incorporating a 3′–3′ Inversion of Polarity Site: A New Route Towards G‐Wire DNA Nanostructures

Oliviero, Giorgia; D’Errico, Stefano; Pinto, Brunella; Nici, Fabrizia; Dardano, Principia; Rea, Ilaria; Stefano, Luca De; Mayol, Luciano; Piccialli, Gennaro; Borbone, Nicola

doi:10.1002/open.201700024

Cited by 26 publications

(25 citation statements)

References 60 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Both GQs showed remarkable antiproliferative activity against cancer cell lines [ 211 ]. Oliviero et al [ 212 ] published on polarity site inversion GQs with the aim of obtaining structurally homogenous DNA G-wire nanostructures, using 5′-CGGT-3′-3′-GGC-5′ sequences. An NMR study performed by Šket et al on the tetramolecular GQs formed by TG 3 T and its analogs containing a 5′-5′ or 3′-3′ inversion of polarity site, namely, the 3′TG5′-5′G 2 T3′, 3′T5′-5′G 3 T3′, and the 5′TG3′-3′G 2 T5′, revealed that the parallel GQs had distinct cation-binding preferences [ 213 ].…”

Section: Stabilization or Destabilization Of A Gq By The Same Syntmentioning

confidence: 99%

In What Ways Do Synthetic Nucleotides and Natural Base Lesions Alter the Structural Stability of G-Quadruplex Nucleic Acids?

Sági¹

2017

Journal of Nucleic Acids

View full text Add to dashboard Cite

Synthetic analogs of natural nucleotides have long been utilized for structural studies of canonical and noncanonical nucleic acids, including the extensively investigated polymorphic G-quadruplexes (GQs). Dependence on the sequence and nucleotide modifications of the folding landscape of GQs has been reviewed by several recent studies. Here, an overview is compiled on the thermodynamic stability of the modified GQ folds and on how the stereochemical preferences of more than 70 synthetic and natural derivatives of nucleotides substituting for natural ones determine the stability as well as the conformation. Groups of nucleotide analogs only stabilize or only destabilize the GQ, while the majority of analogs alter the GQ stability in both ways. This depends on the preferred syn or anti N-glycosidic linkage of the modified building blocks, the position of substitution, and the folding architecture of the native GQ. Natural base lesions and epigenetic modifications of GQs explored so far also stabilize or destabilize the GQ assemblies. Learning the effect of synthetic nucleotide analogs on the stability of GQs can assist in engineering a required stable GQ topology, and exploring the in vitro action of the single and clustered natural base damage on GQ architectures may provide indications for the cellular events.

show abstract

Section: Stabilization or Destabilization Of A Gq By The Same Syntmentioning

confidence: 99%

In What Ways Do Synthetic Nucleotides and Natural Base Lesions Alter the Structural Stability of G-Quadruplex Nucleic Acids?

Sági¹

2017

Journal of Nucleic Acids

View full text Add to dashboard Cite

show abstract

“…The classification of higher-order G4 structures has been outlined in a recent work by Oliviero et al. ( 10 ). According to this classification, the two ‘marginal’ types of multimers are interlocked G-wires, which are composed of mutually slipped G-rich strands, and stacks of G4s, which are held together by interquadruplex pi–pi stacking.…”

Section: Introductionmentioning

confidence: 99%

Polymorphism of G4 associates: from stacks to wires via interlocks

Varizhuk

Protopopova

Цветков

et al. 2018

Nucleic Acids Research

View full text Add to dashboard Cite

We examined the assembly of DNA G-quadruplexes (G4s) into higher-order structures using atomic force microscopy, optical and electrophoretic methods, NMR spectroscopy and molecular modeling. Our results suggest that parallel blunt-ended G4s with single-nucleotide or modified loops may form different types of multimers, ranging from stacks of intramolecular structures and/or interlocked dimers and trimers to wires. Decreasing the annealing rate and increasing salt or oligonucleotide concentrations shifted the equilibrium from intramolecular G4s to higher-order structures. Control antiparallel and hybrid G4s demonstrated no polymorphism or aggregation in our experiments. The modification that mimics abasic sites (1′,2′-dideoxyribose residues) in loops enhanced the oligomerization/multimerization of both the 2-tetrad and 3-tetrad G4 motifs. Our results shed light on the rules that govern G4 rearrangements. Gaining control over G4 folding enables the harnessing of the full potential of such structures for guided assembly of supramolecular DNA structures for nanotechnology.

show abstract

“…Aiming at further confirming the binding of α,ε-PLL with the two G4 models and also at investigating the effect of the addition of α,ε-PLL on the molecularity of Tel22 and Pu22 G4s, we used the HPLC size exclusion chromatography (HPLC-SEC) technique. In other papers, in fact, we and others demonstrated that the HPLC-SEC could be successfully exploited to assess the molecularity and conformational changes of DNA G4s [43][44][45]. Accordingly, we recorded the HPLC-SEC profiles of Tel22 and Pu22 G4s before and 96 h after their incubation with α,ε-PLL ( Figure 8).…”

Section: Resultsmentioning

confidence: 94%

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

et al. 2020

Self Cite

View full text Add to dashboard Cite

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

show abstract

Self‐Assembly of G‐Rich Oligonucleotides Incorporating a 3′–3′ Inversion of Polarity Site: A New Route Towards G‐Wire DNA Nanostructures

Cited by 26 publications

References 60 publications

In What Ways Do Synthetic Nucleotides and Natural Base Lesions Alter the Structural Stability of G-Quadruplex Nucleic Acids?

In What Ways Do Synthetic Nucleotides and Natural Base Lesions Alter the Structural Stability of G-Quadruplex Nucleic Acids?

Polymorphism of G4 associates: from stacks to wires via interlocks

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

Contact Info

Product

Resources

About