Somatostatin Receptor Subtype-2-Deficient Mice with Diet-Induced Obesity Have Hyperglycemia, Nonfasting Hyperglucagonemia, and Decreased Hepatic Glycogen Deposition

Abstract

Hypersecretion of glucagon contributes to abnormally increased hepatic glucose output in type 2 diabetes. Somatostatin (SST) inhibits murine glucagon secretion from isolated pancreatic islets via somatostatin receptor subtype-2 (sst2). Here, we characterize the role of sst2 in controlling glucose homeostasis in mice with diet-induced obesity. Sst2-deficient (sst2(-/-)) and control mice were fed high-fat diet for 14 wk, and the parameters of glucose homeostasis were monitored. Hepatic glycogen and lipid contents were quantified enzymatically and visualized histomorphologically. Enzymes regulating glycogen and lipid synthesis and breakdown were measured by real-time PCR and/or Western blot. Gluconeogenesis and glycogenolysis were determined from isolated primary hepatocytes and glucagon or insulin secretion from isolated pancreatic islets. Nonfasting glucose, glucagon, and fasting nonesterified fatty acids of sst2(-/-) mice were increased. Inhibition of glucagon secretion from sst2-deficient pancreatic islets by glucose or somatostatin was impaired. Insulin less potently reduced blood glucose concentration in sst2-deficient mice as compared with wild-type mice. Sst2-deficient mice had decreased nonfasting hepatic glycogen and lipid content. The activity/expression of enzymes controlling hepatic glycogen synthesis of sst2(-/-) mice was decreased, whereas enzymes facilitating glycogenolysis and lipolysis were increased. Somatostatin and an sst2-selective agonist decreased glucagon-induced glycogenolysis, without influencing de novo glucose production using cultured primary hepatocytes. This study demonstrates that ablation of sst2 leads to hyperglucagonemia. Increased glucagon concentration is associated with impaired glucose control in sst2(-/-) mice, resulting from decreased hepatic glucose storage, increased glycogen breakdown, and reduced lipid accumulation. Sst2 may constitute a therapeutic target to lower hyperglucagonemia in type 2 diabetes.

The diabetes gene Hhex maintains δ-cell differentiation and islet function

“…Islets from Sst À/À mice show elevated insulin and glucagon secretion in response to various secretagogues (Hauge-Evans et al 2009). In addition, Sstr2-deficient mice, which lack paracrine inhibition specifically in a cells, are hyperglycemic due to elevated glucagon secretion (Singh et al 2007).…”

Comparisons of Effects on Intestinal Short-Chain Fatty Acid Concentration after Exposure of Two Glycosidase Inhibitors in Mice

“…The contents of ileum, cecum and colon segment were all removed and put into the EP tube and placed on the ice. These contents were kept frozen until further processing for testing starch concentration, determination of SCFAs and de- R ATAGCTGACCTGTGGCATGA GLUT2-Human F GTACAATGACAGAAGATAAG 53) R TGCTACTAACATGGCTTTGA GLUT2-Mouse F ATGCAACCATTGGTGTTGGG This study R AGGCGAATTTATCCAGCAGC SGLT1-Human F AGCGCCAGCACCCTCTTCACCATGG 54) R CTGGGTTCCATGCAGCTCCCGGTTCC SGLT1-Mouse F TGGAACGCCTTGGTTTTGGT This study R TGAAGATGTAGAGGAGCAGG tection of micro-ecology. The pH of content samples were detected in a 10-fold dilution method as previously described.…”

Benefits and limitations of reducing glucagon action for the treatment of type 2 diabetes

“…Nevertheless, experiments using rodent and human islets demonstrated that glucose-mediated suppression of glucagon secretion may occur independently of GABA or zinc and requires functional KATP channels (48). Somatostatin inhibits glucagon secretion by inhibition of adenylate cyclase and cAMP production, and genetic deletion of the somatostatin receptor subtype 2 is associated with mild hyperglucagonemia and defective glucose-and somatostatin-mediated suppression of glucagon secretion in isolated islets in vitro (65). Similarly, the incretin hormone GLP-1 inhibits glucagon secretion in a glucose-dependent manner through mechanisms requiring the somatostatin receptor subtype 2 (15).…”