Species- and site-specific genome editing in complex bacterial communities

Rubin, Benjamin E. R.; Diamond, Spencer; Cress, Brady F.; Crits-Christoph, Alexander; Lou, Yue Clare; Borges, Adair L.; Shivram, Haridha; He, Christine; Xu, Michael; Zhou, Ze-Hua; Smith, Steven B.; Rovinsky, Rachel; Smock, Dylan C. J.; Tang, Kimberly; Owens, Trenton K.; Krishnappa, Netravathi; Sachdeva, Rohan; Barrangou, Rodolphe; Deutschbauer, Adam M.; Banfield, Jillian F.; Doudna, Jennifer A.

doi:10.1038/s41564-021-01014-7

Cited by 178 publications

(141 citation statements)

References 52 publications

Supporting

Mentioning

140

Contrasting

Order By: Relevance

“…In addition to environmental selection and dispersal, diversification ( i.e. , the generation of novel genetic variation) can contribute to diversity patterns in microbial communities 30, 32, 33 . To explore the role of spatial structuring on viral genotypic heterogeneity across the field site, we profiled within-population genomic variation.…”

Section: Main Textmentioning

confidence: 99%

Spatial turnover of soil viral populations and genotypes overlain by cohesive responses to moisture in grasslands

Santos‐Medellín

Estera-Molina

Yuan

et al. 2022

Preprint

View full text Add to dashboard Cite

Although soil viral abundance, diversity, and potential roles in microbial community dynamics and biogeochemical cycling are beginning to be appreciated, little is known about the patterns and drivers of soil viral community composition that underlie their contributions to terrestrial ecology. Here, we analyzed 43 soil viromes from a precipitation manipulation experiment in a Mediterranean grassland in California, USA. We recovered 5,315 viral population sequences (vOTUs), and viral community composition exhibited a highly significant distance-decay relationship within the 18 m long field. This pattern was recapitulated in the microheterogeneity of 130 prevalent vOTUs (detected in >=90% of the viromes), which tended to exhibit significant negative correlations between genomic similarity of their predominant allelic variants and distance. Although spatial turnover was also observed in the bacterial and archaeal communities from the same soils, the signal was dampened relative to the viromes, suggesting differences in assembly drivers at local scales for viruses and their microbial hosts and/or differences in the temporal scales captured by viromes and total DNA. Despite the overwhelming spatial signal, vOTUs responsive to a decrease in soil moisture were significantly enriched in a predicted protein-sharing subnetwork of 326 vOTUs linked to 191 known actinobacteriophages, suggesting a genomically cohesive viral response to soil moisture evocative of environmental filtering, potentially by way of actinobacterial hosts. Overall, soil viral ecological processes appear to be highly constrained in space and tightly coupled to the heterogeneous, dynamic soil environment and thus fundamentally different from those of their well-mixed and more thoroughly studied marine counterparts.

show abstract

Section: Main Textmentioning

confidence: 99%

Spatial turnover of soil viral populations and genotypes overlain by cohesive responses to moisture in grasslands

Santos‐Medellín

Estera-Molina

Yuan

et al. 2022

Preprint

View full text Add to dashboard Cite

show abstract

“…Although archaeal methanotrophs of the genus Methanoperedens have been studied using cultivation-independent [37] and enrichment-based methods [3], many questions regarding their physiology remain. We hope that this discovery of naturally occurring plasmids associated with Methanoperedens in stable enrichment cultures, paired with the possibility of editing the genomes of specific organisms in microbial communities [38], is a first step towards developing genetic modification approaches to better understand anaerobic oxidation of methane and potentially to harness this process for agricultural and climate engineering.…”

Section: Discussionmentioning

confidence: 99%

A widespread group of large plasmids in methanotrophic Methanoperedens archaea

Schoelmerich

Ouboter

Sachdeva

et al. 2022

Preprint

Self Cite

View full text Add to dashboard Cite

Anaerobic methanotrophic (ANME) archaea conserve energy from the breakdown of methane, an important driver of global warming, yet the extrachromosomal genetic elements that impact the activities of ANME archaea are little understood. Here we describe large plasmids associated with ANME archaea of the Methanoperedens genus. These have been maintained in two bioreactors that contain enrichment cultures dominated by different Methanoperedens species and co-occur with Methanoperedens species in other anoxic environments. By manual curation we show that two of the plasmids are large (155,607 bp and 191,912 bp), circular, and replicate bidirectionally. The group of Methanoperedens species that carry these plasmids is related to "Ca. Methanoperedens nitroreducens", "Ca. Methanoperedens ferrireducens", "Ca. Methanoperedens manganicus" and the plasmids occur in the same copy number as the main chromosome. The larger plasmid encodes transporters that potentially enhance access to Ni, which is required for the methyl-CoM reductase (Mcr), Co required for the cobalamin cofactor needed for methyltransferases, and amino acid uptake. We show that many plasmid genes are actively transcribed, including genes involved in plasmid chromosome maintenance and segregation, a Co2+/Ni2+ transporter and cell protective proteins. Notably, one plasmid carries three tRNAs and two colocalized genes encoding ribosomal protein uL16 and elongation factor eEF2. These are not encoded in the host Methanoperedens genome and uL16 and eEF2 were highly expressed, indicating an obligate interdependence between this plasmid and its host. The finding of plasmids of Methanoperedens opens the way for the development of genetic vectors that could be used to probe little understood aspects of Methanoperedens physiology. Ultimately, this may provide a route to introduce or alter genes that may enhance growth and overall metabolism to accelerate methane oxidation rates.

show abstract

“…DNA fragments were size selected using AMPure XP magnetic beads (Beckman Coulter, United States) at the recommended ratios 0.4X and 0.2X. We used a modified version of the protocol described in Wetmore et al (2015) , with a two-step PCR used to enrich for transposon insertion sites, based on ( Rubin et al, 2021 ). A custom splinkerette adapter was ligated to fragmented DNA, prepared by annealing oligos:/5Phos/G*ATCGGAAGAGCACACGTCTGGGTTTTTT TTTTCAAAAAAA*A and G*AGATCGGTCTCGGCATTCCC AGACGTGTGCTCTTCCGATC*T ( Rubin et al, 2021 ).…”

Section: Methodsmentioning

confidence: 99%

“…We used a modified version of the protocol described in Wetmore et al (2015) , with a two-step PCR used to enrich for transposon insertion sites, based on ( Rubin et al, 2021 ). A custom splinkerette adapter was ligated to fragmented DNA, prepared by annealing oligos:/5Phos/G*ATCGGAAGAGCACACGTCTGGGTTTTTT TTTTCAAAAAAA*A and G*AGATCGGTCTCGGCATTCCC AGACGTGTGCTCTTCCGATC*T ( Rubin et al, 2021 ). Between rounds of PCR and before submitting for sequencing, DNA was cleaned by binding to AMPure XP magnetic beads, using a bead ratio of 0.9X and eluted in 15 μl 0.1X TE buffer for intermediate steps and 30 μl 0.1X TE for sequencing.…”

Section: Methodsmentioning

confidence: 99%

Genome-Wide Identification of Genes Important for Growth of Dickeya dadantii and Dickeya dianthicola in Potato (Solanum tuberosum) Tubers

2022

View full text Add to dashboard Cite

Dickeya species are causal agents of soft rot diseases in many economically important crops, including soft rot disease of potato (Solanum tuberosum). Using random barcode transposon-site sequencing (RB-TnSeq), we generated genome-wide mutant fitness profiles of Dickeya dadantii 3937, Dickeya dianthicola ME23, and Dickeya dianthicola 67-19 isolates collected after passage through several in vitro and in vivo conditions. Though all three strains are pathogenic on potato, D. dadantii 3937 is a well-characterized model while D. dianthicola strains ME23 and 67-19 are recent isolates. Strain ME23 specifically was identified as a representative strain from a 2014 outbreak on potato. This study generated comparable gene fitness measurements across ecologically relevant conditions for both model and non-model strains. Tubers from the potato cultivars “Atlantic,” “Dark Red Norland,” and “Upstate Abundance” provided highly similar conditions for bacterial growth. Using the homolog detection software PyParanoid, we matched fitness values for orthologous genes in the three bacterial strains. Direct comparison of fitness among the strains highlighted shared and variable traits important for growth. Bacterial growth in minimal medium required many metabolic traits that were also essential for competitive growth in planta, such as amino acid, carbohydrate, and nucleotide biosynthesis. Growth in tubers specifically required the pectin degradation gene kduD. Disruption in three putative DNA-binding proteins had strain-specific effects on competitive fitness in tubers. Though the Soft Rot Pectobacteriaceae can cause disease with little host specificity, it remains to be seen the extent to which strain-level variation impacts virulence.

show abstract

Species- and site-specific genome editing in complex bacterial communities

Cited by 178 publications

References 52 publications

Spatial turnover of soil viral populations and genotypes overlain by cohesive responses to moisture in grasslands

Spatial turnover of soil viral populations and genotypes overlain by cohesive responses to moisture in grasslands

A widespread group of large plasmids in methanotrophic Methanoperedens archaea

Genome-Wide Identification of Genes Important for Growth of Dickeya dadantii and Dickeya dianthicola in Potato (Solanum tuberosum) Tubers

Contact Info

Product

Resources

About