Status, Antimicrobial Mechanism, and Regulation of Natural Preservatives in Livestock Food Systems

Lee, Na‐Kyoung; Paik, Hyun‐Dong

doi:10.5851/kosfa.2016.36.4.547

Cited by 54 publications

(32 citation statements)

References 84 publications

(86 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…A novel trend is arising from health-conscious consumers expecting that natural antimicrobials act only against foodborne pathogens leaving the consumers' microbiome out of their scope [1]. The negative effect of some synthetic preservatives on consumers' health is leading to more research to evaluate that natural antimicrobials fulfil food safety regulations [4]; the inadequate use of antibiotics leading to multidrug-resistant microorganisms also justify and reinforce the focus on natural antimicrobials [2]. Natural antimicrobials ensure food safety from a new perspective increasing its shelf-life; furthermore, their direct incorporation to different foods from different origins such as meat or vegetables as well as to their packaging give, as a result, the extension of their shelf-life [1,5].…”

Section: Natural Antimicrobials From Plantsmentioning

confidence: 99%

Food Safety through Natural Antimicrobials

et al. 2019

View full text Add to dashboard Cite

Microbial pathogens are the cause of many foodborne diseases after the ingestion of contaminated food. Several preservation methods have been developed to assure microbial food safety, as well as nutritional values and sensory characteristics of food. However, the demand for natural antimicrobial agents is increasing due to consumers’ concern on health issues. Moreover, the use of antibiotics is leading to multidrug resistant microorganisms reinforcing the focus of researchers and the food industry on natural antimicrobials. Natural antimicrobial compounds from plants, animals, bacteria, viruses, algae and mushrooms are covered. Finally, new perspectives from researchers in the field and the interest of the food industry in innovations are reviewed. These new approaches should be useful for controlling foodborne bacterial pathogens; furthermore, the shelf-life of food would be extended.

show abstract

Section: Natural Antimicrobials From Plantsmentioning

confidence: 99%

Food Safety through Natural Antimicrobials

et al. 2019

View full text Add to dashboard Cite

show abstract

“…Altering bacterial communication, exerted by plant natural therapies was demonstrated by qRT-PCR and was reported to be induced by downregulation of quorum-sensing already established genes [58]. Also, transcription processes as well as replication of nucleic acids (DNA/RNA) were reported [59].…”

Section: Alterations In Regulation Of Gene Expressionmentioning

confidence: 99%

Nano-Antimicrobial Solutions Using Synthetic-Natural Hybrid Designs

Mocan¹,

Moşteanu²,

Matea³

et al. 2019

Nanomedicines

View full text Add to dashboard Cite

Nanotechnology potential in antimicrobial therapy is increasingly demonstrated by various data. Results reveal antibacterial properties, comparable to that of conventional antibiotics. Working on parallel experiments, researchers continue to bring evidence demonstrating age-old-recognized antibacterial properties of various natural components of plant and animal origin. Later years brought an increasing trend for combining synthetic and natural composition in new constructs. The tendency aims to bring more on different essential aspects, such as active substance release, improvement of antibacterial effect, and up-regulation of the mechanisms at the structure-cell interface. Present chapter structures the up-to-date achievements in the field, including the concept of design, biological effects, benefits, mechanisms, and limitations of the field. Also, expected future research directions are to be discussed.

show abstract

“…The same peptide is also produced by the marine bacterial strain PL26 of Bacillus licheniformis, isolated from the west coast of India [2]. Due to its well-known antimicrobial properties, ε-PLL is largely used worldwide as a food preservative [3,4], but is also used in many biomedical applications, including the enhancement of some anticancer agents [5], the suppression of the production of the prion protein in neurodegenerative disorders [6], the use in contrast agent probes for Magnetic Resonance Imaging [7] and the enhancement of gene delivery efficiency [8]. The industrial production of ε-PLL makes use of a mutant of Streptomyces albulus [9].…”

Section: Introductionmentioning

confidence: 99%

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

et al. 2020

View full text Add to dashboard Cite

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

show abstract

Status, Antimicrobial Mechanism, and Regulation of Natural Preservatives in Livestock Food Systems

Cited by 54 publications

References 84 publications

Food Safety through Natural Antimicrobials

Food Safety through Natural Antimicrobials

Nano-Antimicrobial Solutions Using Synthetic-Natural Hybrid Designs

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

Contact Info

Product

Resources

About