Synthesis of New N-(Trifluoroacetyl) Doxorubicin Analogues

Bérubé, Gervais; Richardson, V. J.; Ford, C. H. J.

doi:10.1080/00397919108019778

Cited by 9 publications

(5 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Purified chitosans 15, 100, and 200 KD (90% deacetylation) were from Polysciences Inc. (Warrington, U.S.A.) and used as supplied. Doxorubicin hydrochloride was generously provided by Pharmacia/Farmitalia Carlos Erba, Italy, and N -(trifluoroacetyl) doxorubicin was synthesized according to the published methods. , Other chemicals were of reagent grade and used as supplied.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Encapsulation of Antitumor Drug Doxorubicin and Its Analogue by Chitosan Nanoparticles

2013

View full text Add to dashboard Cite

Biodegradable chitosan of different sizes were used to encapsulate antitumor drug doxorubicin (Dox) and its N-(trifluoroacetyl) doxorubicin (FDox) analogue. The complexation of Dox and FDox with chitosan 15, 100, and 200 KD was investigated in aqueous solution, using FTIR, fluorescence spectroscopic methods, and molecular modeling. The structural analysis showed that Dox and FDox bind chitosan via both hydrophilic and hydrophobic contacts with overall binding constants of K(Dox-ch-15) = 8.4 (±0.6) × 10(3) M(-1), K(Dox-ch-100) = 2.2 (±0.3) × 10(5) M(-1), K(Dox-ch-200) = 3.7 (±0.5) × 10(4) M(-1), K(FDox-ch-15) = 5.5 (±0.5) × 10(3) M(-1), K(FDox-ch-100) = 6.8 (±0.6) × 10(4) M(-1), and K(FDox-ch-200) = 2.9 (±0.5) × 10(4) M(-1), with the number of drug molecules bound per chitosan (n) ranging from 1.2 to 0.5. The order of binding is ch-100 > 200 > 15 KD, with stronger complexes formed with Dox than FDox. The molecular modeling showed the participation of polymer charged NH(2) residues with drug OH and NH(2) groups in the drug-polymer adducts. The presence of the hydrogen-bonding system in FDox-chitosan adducts stabilizes the drug-polymer complexation, with the free binding energy of -3.89 kcal/mol for Dox and -3.76 kcal/mol for FDox complexes. The results show chitosan 100 KD is a more suitable carrier for Dox and FDox delivery.

show abstract

Section: Methodsmentioning

confidence: 99%

“…Doxorubicin hydrochloride was generously provided by Pharmacia/Farmitalia Carlos Erba, Italy, and N-(trifluoroacetyl) doxorubicin was synthesized according to the published methods. 25,26 Other chemicals were of reagent grade and used as supplied.…”

Section: ■ Experimental Sectionmentioning

confidence: 99%

Encapsulation of Antitumor Drug Doxorubicin and Its Analogue by Chitosan Nanoparticles

2013

View full text Add to dashboard Cite

show abstract

“…For this purpose, we designed the monomethoxytrityl-(MMt)-protected 5′- bis -amino-modifier 2 , which was introduced as the terminal phosphoramidite during DNA solid-phase synthesis and deprotected on solid-support by repeated washes with 2% trichloroacetic acid in DCM. Compound 2 was conveniently prepared in two steps and 83% overall yield by coupling two molecules of N -MMt-3-aminopropionic acid [12] to 1,3-diamino-2-propanol followed by the formation of the phosphoramidite (Scheme 1). The same 5′-bis- amino-modifier 2 was also used for the preparation of the DNA probes with two TPP-groups (dual TPP-DNAs, Figure 1c) by postsynthetic conjugation of 4-(diphenylphosphino)benzoic acid to 3′-amine-modified DNA synthesized in the reverse (5′→3′) direction.…”

Section: Resultsmentioning

confidence: 99%

“…To a solution of N’ -(4-monomethoxytrityl)-β-alanine [12] (1.45 g, 4.0 mmol) in anhydrous DCM (10 mL) was added N,N′ -dicyclohexylcarbodiimide (0.82 g, 4.0 mmol), 1,3-diamino-2-propanol (0.16 g, 1.8 mmol), and a catalytic amount of 4-(dimethylamino)pyridine (50 mg). The mixture was stirred for 14 h at room temperature.…”

Section: Methodsmentioning

confidence: 99%

Two Successive Reactions on a DNA Template: A Strategy for Improving Background Fluorescence and Specificity in Nucleic Acid Detection

Franzini

Kool

2011

Chemistry A European J

View full text Add to dashboard Cite

We report a new strategy for template-mediated fluorogenic chemistry that results in enhanced performance for the fluorescence detection of nucleic acids. In this approach, two successive templated reactions are required to induce a fluorescence signal, rather than only one. These novel fluorescein-labeled oligonucleotide probes, termed 2-STAR probes, contain two quencher groups tethered by separate reductively cleavable linkers. When a 2-STAR quenched probe binds adjacent to either two successive mono triphenyl-phosphine (TPP)-DNAs or a dual TPP-DNA, the two quenchers are released, resulting in a fluorescence signal. Because of the requirement for two consecutive reactions, 2-STAR probes display an unprecedented level of sequence-specificity for template-mediated probe designs. At the same time, background emission generated by off-template reactions or incomplete quenching is among the lowest of any fluorogenic reactive probes for the detection of DNA or RNA.

show abstract

“…To achieve the stepwise synthesis of DNG−Hoechst conjugates with different linker lengths, we chose 10 and 15 as building blocks (Schemes and ). The 6-monomethoxytritylamino-hexanoic acid ( 10 ) was prepared easily, in ∼95% yield, through the reaction of commercially available 6-aminohexanoic acid ( 9 ) with MMTrCl in dry pyridine (Scheme ). The Hoechst acid 15 was synthesized as described in Scheme .…”

Section: Resultsmentioning

confidence: 99%

Solid-Phase Synthesis of Positively Charged Deoxynucleic Guanidine (DNG) Tethering a Hoechst 33258 Analogue: Triplex and Duplex Stabilization by Simultaneous Minor Groove Binding

Reddy

Bruice

2004

J. Am. Chem. Soc.

View full text Add to dashboard Cite

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.

show abstract

Synthesis of New N-(Trifluoroacetyl) Doxorubicin Analogues

Cited by 9 publications

References 17 publications

Encapsulation of Antitumor Drug Doxorubicin and Its Analogue by Chitosan Nanoparticles

Encapsulation of Antitumor Drug Doxorubicin and Its Analogue by Chitosan Nanoparticles

Two Successive Reactions on a DNA Template: A Strategy for Improving Background Fluorescence and Specificity in Nucleic Acid Detection

Solid-Phase Synthesis of Positively Charged Deoxynucleic Guanidine (DNG) Tethering a Hoechst 33258 Analogue: Triplex and Duplex Stabilization by Simultaneous Minor Groove Binding

Contact Info

Product

Resources

About