The non-classical MHC class I molecule Qa-1b inhibits classical MHC class I-restricted cytotoxicity of cytotoxic T lymphocytes

Abstract

The CD94/NKG2A heterodimer is an inhibitory receptor expressed on a subset of mouse NK cells. CD94/NKG2A recognizes the non-classical MHC class I (class Ib) molecule Qa-1(b) and inhibits NK cytotoxicity. Qa-1(b) presents a peptide derived from the leader sequence of classical MHC class I molecules. Here, we examined the role of CD94/NKG2A in T cell-mediated cytotoxicity. Soluble tetrameric Qa-1(b) bound to almost all CD8(+), but not CD4(+), T cells. This binding seems to be mediated by CD8, because COS cells transfected with CD8 also bound Qa-1(b) tetramer. Therefore, the expression of CD94/NKG2 in T cells was further examined by single-cell RT-PCR. Most murine CD8(+) T cells constitutively expressed CD94 and NKG2A transcripts, whereas they were not detected in CD4(+) T cells. Co-expression of Qa-1(b) and D(k) on target cells significantly inhibited cytotoxicity of D(k)-specific cytotoxic T lymphocytes generated by mixed lymphocyte reaction, indicating that Qa-1(b) on antigen-presenting cells interacts with CD94/NKG2A on CD8 T cells and regulates classical MHC class I-restricted cytotoxic T cells. These results suggest a significant role of CD94/NKG2A as an inhibitory receptor on CD8(+) T cells.

Amelioration of acute graft-versus-host disease by NKG2A engagement on donor T cells

“…A similar scenario may be applicable to the CD94/NKG2A expressed on donor T cells during aGVHD, which may represent an intrinsic mechanism that limits aGVHD pathology. Consistent with this notion, donor T cells expanded progressively in the spleen and liver during days 7-14 after transfer, but this expansion was rather suppressed during days [14][15][16][17][18][19][20][21] in the present aGVHD model (Fig. 4).…”

“…It has recently been reported that CD94/NKG2A can be also expressed by T cells and inhibit T cell activation in vitro [17][18][19][20][21][22]. Moreover, increased expression of CD94 on human peripheral blood CD8 + T cells has been noted after allogeneic BMT [23].…”

A Peptide from Heat Shock Protein 60 Is the Dominant Peptide Bound To Qa-1 in the Absence of the MHC Class Ia Leader Sequence Peptide Qdm

“…Results from murine studies largely corroborate with the data obtained from human-based experiments. CD94/NKG2A partially inhibits murine allospecific CTL cytotoxicity and inhibits polyoma virus-specific CTL lysis, but not IFN-␥ production (55,56,62). However, CD94/NKG2A does not inhibit OVA peptide (SIINFEKL)-specific or lymphocytic choriomeningitis virus-specific CTL effector function (56,57).…”

Orderly and Nonstochastic Acquisition of CD94/NKG2 Receptors by Developing NK Cells Derived from Embryonic Stem Cells In Vitro

“…granzyme B, AGAGGACTAGAGCTGTGAGG; perforin, CACAGTAG AGTGTCCGATGTA; CD94, AACAATTGCACTGATGCCCAA; NKG2A/C, TCCTTCGGAAGGGCAGAGGTCA; NKG2E, CAAACTTATGCTCTT TGTCCA; NKG2D, GAGTCCTTGCTATAGCCTTG; ␤-actin, CAAGT GCTTCTAGGCGGACTGT. Probes for Ly49B and Ly49I were previously described (15,30,31). The oligonucleotides were 32 P-labeled using terminal transferase and hybridized at 58°C to Southern blots.…”