Uji Ketahanan Galur-galur Harapan Padi terhadap Penyakit Hawar Daun Bakteri (Xanthomonas oryzae pv. oryzae) Ras III, IV, dan VIII

Yuriyah, Siti; Utami, Dwinita Wikan; Hanarida, Ida

doi:10.21082/blpn.v19n2.2013.p53-60

Cited by 11 publications

(11 citation statements)

References 6 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Balai Besar Penelitian Tanaman Padi (2015) menyebutkan bahwa bakteri patogen Xanthomonas mampu membentuk strain atau patotipe yang lebih virulen yang menyebabkan terjadinya pergeseran dominasi patogen dari waktu ke waktu sehingga ketahanan inang menjadi lebih rentan. Penelitian Yuriah et al, 2013 menyebutkan bahwa tanaman padi dengan varietas IR 64 merupakan tanaman padi yang rentan oleh bakteri Xanthomonas tipe III yang dominan di Sulawesi, Kalimantan, Jawa dan Bali.…”

Section: Pendahuluanunclassified

Identifikasi Penyebab Penyakit Hawar Daun Bakteri Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo

Laraswati¹,

Ramdan²,

Kulsum³

et al. 2021

Peningkatan Produktivitas Pertanian Era Society 5.0 Pasca Pandemi

View full text Add to dashboard Cite

Hawar daun bakteri (HDB) merupakan salah satu penyakit penting tanaman padi dengan kehilangan hasil mencapai 15-80%. Manipulasi iklim mikro melalui teknik pola tanam menjadi salah satu upaya pengendalian penyakit ini. Oleh karena itu, pada penelitian ini akan diidentifikasi penyebab penyakit HDB pada kombinasi pola tanam system of rice intensification (SRI) dan jajar legowo. Penelitian dilakukan di Balai Besar Peramalan Organisme Pengganggu Tanaman (BBPOPT), Jatisari, Karawang mulai bulan Agustus sampai September 2020. Kombinasi pola tanaman terdiri dari (1) SRI dengan kombinasi jarwo 2:1, (2) SRI dengan kombinasi jarwo 3:1, (3) SRI dengan kombinasi jarwo 4:1, (4) SRI dengan kombinasi jarwo 5:1, (5) SRI tanpa kombinasi, dan (6) Sistem tanem tegal (konvensional). Setiap petak kemudian dibagi menjadi 5 subpetak sebagai ulangan (1 titik di setiap sudut petak dan 1 titik di tengah-tengah petak). Gejala, kejadian dan keparahan penyakit diamati pada masing-masing subpetak. Tanaman yang menunjukkan gejala kemudian diidentifikasi secara molekuler dengan teknik polymerase chain reaction (PCR) meliputi proses ekstraksi total DNA dan amplifikasi nukleotida dengan menggunakan pasangan primer forward (F:CCTCTATGAGTCGGGAGCTG) dan primer reverse (R: ACACCGTGATGCAATGAAGA). Hasil pengamatan menunjukkan gejala berupa bercak abu-abu di tepi daun kemudian berkembang ke arah pangkal daun baik di satu atau dua sisi daun. Selanjutnya daun menjadi tidak beraturan dan mengering. Kejadian penyakit HDB sebesar 81.67 – 95%, sedangkan keparahan penyakit sebesar 27.97 – 42.44% disemua pola tanaman. Identifikasi dengan teknik PCR menunjukkan bahwa penyebab penyakit HDB adalah Xanthomonas oryzae pv. oryzae yang teramplifikasi pada band ukuran 230 – 250 bp.

show abstract

Section: Pendahuluanunclassified

Identifikasi Penyebab Penyakit Hawar Daun Bakteri Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo

Laraswati¹,

Ramdan²,

Kulsum³

et al. 2021

Peningkatan Produktivitas Pertanian Era Society 5.0 Pasca Pandemi

View full text Add to dashboard Cite

show abstract

“…Meanwhile, the BLB isolates used for resistance evaluation were pure isolates cultures of races III, IV, and VIII, as the BLB's dominant races in BLB endemic locations (Yuriyah et al 2013). The purebred cultures used were the collection of the Center for Research and Development on Biotechnology and Agricultural Genetic Resources (ICABIOGRAD) (Table 2).…”

Section: Genetic Materialsmentioning

confidence: 99%

Phenotype and genotype variability of interspecific rice lines related to bacterial leaf blight resistance (Xanthomonas oryzae pv. oryzae) character

et al. 2021

Self Cite

View full text Add to dashboard Cite

Abstract. Yuriyah S, Darnaedi D, Setia TM, Windarsih G, Utami DW. 2021. Phenotype and genotype variability of interspecific rice lines related to bacterial leaf blight resistance (Xanthomonas oryzae pv. oryzae) character. Biodiversitas 22: 4123-4130. Wild rice species are the source of the gene pool for rice genetic diversity. The cross-species crosses (interspecific crosses) play an important role in breeding, namely in terms of expanding the diversity of desirable characters, such as disease resistance and improvement in yield potential. Currently, the genes from wild rice species have been successfully introgressed into cultivated rice so that they can overcome the rice production constraints, including the introgression of genes for the bacterial leaf blight (BLB) resistance. The purpose of this study was to analyze the variability of phenotype and genotype performance of lines derived from wild rice species for the character of resistance to BLB disease. A total of 33 selected backcross lines derived from wild rice species of O. rufipogon and O. glaberrima as the donor parents and 2 control varieties (resistant and susceptible to BLB disease), were used in this study. The evaluation of phenotype and genotype of resistance characters to BLB disease was carried out during a vegetative phase of the plant. The resistance evaluation was carried out in a greenhouse, while the genotype performance was analyzed using 4 STS markers linked to Xa4, Xa7, and Xa13 genes. The result of the phenotype evaluation showed that there were variations among the resistance of the tested lines. Three lines derived from a Situ Bagendit/Oryza rufipogon cross were resistant to all BLB races used in the testing. Those three lines indicated to have the allele of the Xa7 resistance gene based on the genotype performance which grouped with the Code variety that had the Xa7 resistance gene.

show abstract

“…Pada galur yang peka, 3 hari setelah inokulasi (hsi) ujung daun layu diiringi dengan terbentuknya bercak kelabu pada tepi daun, kemudian daun mengerut dan menggulung ke arah dalam. Pada 7 hsi, mulai timbul gejala hawar berwarna putih kering pada ujung daun menuju titik tumbuh dan pada 14-59 hsi seluruh bagian daun berwarna putih kecokelatan hingga daun menjadi cokelat kering (Yuriyah et al, 2013).…”

Section: Pendahuluanunclassified

Identifikasi Gen Ketahanan terhadap (Xanthomonasoryzae pv. Oryzae), penyebab Penyakit Hawar Daun Bakteri padaPlasma Nutfah Padi Lokal Sulawesi Selatan

Yuriyah¹,

Nurani

Utami³

et al. 2018

J. AgroBiogen

Self Cite

View full text Add to dashboard Cite

One of the limiting factors on rice production, especially in South Sulawesi, is the bacterial leaf blight (BLB) disease infection caused by Xanthomonas oryzae pv. oryzae (Xoo). The use of resistant variety is considered as the most effective method to control Xoo. Local cultivar could serve as resistance source for Xoo resistance. The objectives of this research were to evaluate and identify markers for Xoo resistance in rice local cultivars from South Sulawesi based on comparison with the resistance response of the differential varieties and association analysis between resistance phenotype and genotype of molecular markers. Three Xoo races (race III, IV, and VIII) were tested on IRBB differential lines and local cultivars. The genotype analysis was done by using the molecular marker linked to Xoo resistance. Meanwhile, the association analysis was done by combination analysis (U-joint) using generalized linear model (GLM). The resistance test result showed that single gene isogenic lines (IRBB 5, IRBB 7, and IRBB 21), multiple genes isogenic lines (IRBB 50, IRBB 52, IRBB 53, IRBB 54, IRBB 56, IRBB 58, IRBB 64, and IRBB 66), and Ase Andele accession were resistant to the three Xoo races. Association test obtained one significant marker that associated with the resistance to race III (marker Xa26-STS2), four markers significantly associated with the resistance to race IV (Xa1-STS15, Xa4-STS44, xa13-STS51, and Xa21-STS6), and two markers significantly associated with the resistance to race VIII (Xa7-STS57 and RM 20589). Keywords:Resistance gene, bacterial leaf blight, germplasm. ABSTRAKSalah satu faktor pembatas produksi padi, di Sulawesi Selatan khususnya, adalah serangan penyakit hawar daun bakteri (HDB) yang disebabkan oleh Xanthomonas oryzae pv. oryzae (Xoo). Upaya yang dipandang efektif untuk mengendalikan penyakit HDB adalah penanaman varietas tahan. Perakitan varietas padi dengan menggunakan gen-gen tahan dari berbagai kultivar berpeluang menghasilkan varietas tahan HDB. Kultivar lokal berperan sebagai salah satu sumber keragaman genetik untuk beberapa sifat ketahanan penyakit. Penelitian ini bertujuan mengevaluasi dan mengidentifikasi marka penanda gen ketahanan penyakit hawar daun bakteri pada padi lokal Sulawesi Selatan berdasarkan sistem standar diferensial dan analisis molekuler. Analisis uji ketahanan fenotipe dilakukan menggunakan tiga ras HDB (ras III, IV, dan VIII) dan galur diferensial (galur IRBB). Analisis genotipe dilakukan menggunakan marka molekuler terkait ketahanan terhadap HDB yang ditampilkan sebagai dendrogram keragaman. Analisis asosiasi dilakukan dengan analisis gabungan (U-joint) menggunakan generalized linear model (GLM). Hasil pengujian ketahanan menunjukkan galur isogenik dengan gen tunggal (IRBB 5, IRBB 7, dan IRBB 21), galur isogenik dengan multipel gen (IRBB 50, IRBB 52, IRBB 53, IRBB 54, IRBB 56, IRBB 58, IRBB 64, dan IRBB 66), dan aksesi Ase Andele bersifat tahan terhadap ketiga ras uji. Dari uji asosiasi, diperoleh satu marka signifikan yang berasosiasi dengan k...

show abstract

Uji Ketahanan Galur-galur Harapan Padi terhadap Penyakit Hawar Daun Bakteri (Xanthomonas oryzae pv. oryzae) Ras III, IV, dan VIII

Cited by 11 publications

References 6 publications

Identifikasi Penyebab Penyakit Hawar Daun Bakteri Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo

Identifikasi Penyebab Penyakit Hawar Daun Bakteri Pada Kombinasi Pola Tanam System of Rice Intensification (SRI) dan Jajar Legowo

Phenotype and genotype variability of interspecific rice lines related to bacterial leaf blight resistance (Xanthomonas oryzae pv. oryzae) character

Identifikasi Gen Ketahanan terhadap (Xanthomonasoryzae pv. Oryzae), penyebab Penyakit Hawar Daun Bakteri padaPlasma Nutfah Padi Lokal Sulawesi Selatan

Contact Info

Product

Resources

About