Xenon Enhances LPS-Induced IL-1β Expression in Microglia via the Extracellular Signal-Regulated Kinase 1/2 Pathway

Fahlenkamp, Astrid; Coburn, Mark; Haase, Hajo; Kipp, Markus; Ryang, Yu‐Mi; Rossaint, Rolf; Beyer, Cordian

doi:10.1007/s12031-010-9432-z

Cited by 20 publications

(12 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In vitro investigations suggest that xenon has pro-inflammatory effects, increasing TNF-α and IL-6 [66], and IL-1β [67] in LPSmediated cultures. A recent study on adults did not show any differences in leucocyte function in peripheral blood with xenon compared to sevoflurane [63].…”

Section: Inhalational Anestheticsmentioning

confidence: 99%

“…Xenon is an odorless noble gas, normally present in traces in Earth's atmosphere, and it has been used as volatile anesthetic [64]. It has shown hemodynamic stability, fast recovery and neuroprotective proprieties but high costs [65].In vitro investigations suggest that xenon has pro-inflammatory effects, increasing TNF-α and IL-6 [66], and IL-1β [67] in LPSmediated cultures. A recent study on adults did not show any differences in leucocyte function in peripheral blood with xenon compared to sevoflurane [63].…”

mentioning

confidence: 99%

See 1 more Smart Citation

Anesthesia, cytokines and cancer recurrence

Kitamura¹,

Biaso²,

Ingelmo

et al. 2015

Glob Anesth Perioper Med

View full text Add to dashboard Cite

Cytokines are essential mediators for the regulation of both innate and acquired immunity and hematopoiesis. They modulate immune cell signaling, activation, adhesion and functioning. They regulate the individual response to several insults such as infection, inflammation, trauma, and pain. Moreover, the balance between pro-inflammatory and anti-inflammatory cytokines is critical for the evolution of surgical complications and tumor progression.Several drugs, including anesthetic agents, influence cytokines secretion. Opioids, inhalational agents, intravenous and local anesthetics have shown different effects on immune system and cytokine expression. Therefore, anesthesia may play an important role in postoperative recovery and outcome of cancer patients.The aim of the present article is to review the main role of some important cytokines and the effect of anesthesia techniques and drugs on their secretion. Furthermore, current clinical evidence regarding the effects of anesthesia on cancer recurrence will be discussed. Cytokines and immune systemCytokines are proteins expressed in both innate and acquired immune system and are often named according to the secreting cells (i.e., lymphocytes, interleukins, etc.). They are essential mediators of the natural (non-specific, innate) immunity, which is the initial step of the inflammatory response. They also play a pivotal role during the specific immunity, which occurs after exposure to antigens, as they regulate lymphocyte and leukocyte activation, growth and differentiation, and the immune-mediated inflammation [1].The cytokines have different structures, but also common aspects, which are summarized in Table 1.The aim of the present article is to review the main role of some important cytokines and the effect of anesthesia techniques and drugs on their secretion. Cytokines receptorsThe cytokines receptors are formed by one or more transmembrane proteins: the extracellular portion binds the cytokine, whereas the cytoplasmic part starts the signal cascade. Based on the extracellular portion, they are divided in five categories. 1) Type I receptors, which have four α-helical stands and contain four cysteine residues and the amino acid motif tryptophanserine-X-tryptophan-serine (WSXWS).2) Type II receptors, structurally similar to Type I receptors, but without the sequence WSXWS. Cytokines functionProvided that the same cytokine may be produced during both innate and acquired immunity response, cytokines can be classified according to their functions: 1)Cytokines regulating the innate immunity and secreted by stimulated macrophages; 2)Cytokines regulating the acquired immunity and secreted by lymphocytes; 3)Cytokines stimulating the hematopoiesiss and secreted by bone marrow, leucocytes and other cells. Common aspects of CytokineTheir secretion is brief and limited in time Cytokine expressed during the innate immunity response Tumor necrosis factor (TNF-α, TNF-β)The TNF is responsible for the initial phase of acute inflammatory response, especially against ...

show abstract

Section: Inhalational Anestheticsmentioning

confidence: 99%

mentioning

confidence: 99%

Anesthesia, cytokines and cancer recurrence

Kitamura¹,

Biaso²,

Ingelmo

et al. 2015

Glob Anesth Perioper Med

View full text Add to dashboard Cite

show abstract

“…Transcripts of an exon-intron spanning hypoxanthine guanine phosphoribosyl transferase (HPRT) served as control for cDNA purity (BioTaq TM PCR Kit, Bioline, Luckenwalde, Germany). Real-time PCR (RT-PCR) analysis was performed with the SensiMix SYBR Green Kit (Quantace, Bioline Hamburg, Germany) on a MyIQ qRT-PCR detection system (Bio-Rad) as described previously [20]. Transcripts of interleukin (IL)-1b (s CTGTGTCTTTCCCGTGGACC; as CAGCTCAT ATGGGTCCGACA), as well as CCL2 (s TTAAAAACC TGGATCGGAACCAA; as GCATTAGCTTCAGATTTA CGGGT), CXCL10 (s TAGCTCAGGCTCGTCAGTTCT; as GATGGTGGTTAAGTTCGTGCT), CXCL11 (s GGC TTCCTTATGTTCAAACAGGG; as GCCGTTACTCGGG TAAATTACA) and LIF (s GCCTCCCTGACCAATA TCACCCG; as GACGGCAAAGCACATTGCTG) were amplified.…”

Section: Real-time Pcr (Rt-pcr)mentioning

confidence: 99%

“…Transcripts of interleukin (IL)-1b (s CTGTGTCTTTCCCGTGGACC; as CAGCTCAT ATGGGTCCGACA), as well as CCL2 (s TTAAAAACC TGGATCGGAACCAA; as GCATTAGCTTCAGATTTA CGGGT), CXCL10 (s TAGCTCAGGCTCGTCAGTTCT; as GATGGTGGTTAAGTTCGTGCT), CXCL11 (s GGC TTCCTTATGTTCAAACAGGG; as GCCGTTACTCGGG TAAATTACA) and LIF (s GCCTCCCTGACCAATA TCACCCG; as GACGGCAAAGCACATTGCTG) were amplified. Relative amounts of transcripts were calculated with the delta CT-method and normalized to transcripts (s TGACCACAGTCCATGCCATC; as GACGCACACA TTGGGGGTAG) of a reference housekeeping gene (glucose aldehyde phosphate dehydrogenase, GAPDH) [20]. Its stable expression compared to other housekeeping genes was tested beforehand (data not shown).…”

Section: Real-time Pcr (Rt-pcr)mentioning

confidence: 99%

Expression analysis of the early chemokine response 4 h after in vitro traumatic brain injury

et al. 2010

Self Cite

View full text Add to dashboard Cite

show abstract

“…[9] It can enhance lipopolysaccharide-induced interleukin-1 beta (IL-1β) expression in microglia by activating extracellular signal-regulated kinase 1/2, [10] inhibiting caspase-3 activation and cytochrome c release from cells, [11] and reducing serum levels of the pro-inflammatory cytokines, such as IL-1, IL-6, and tumor necrosis factor alpha (TNFα) in rats. [12,13] In addition, in recent years, it was shown that xenon had neuroprotective, cardioprotective, and renoprotective effects in different animal models subjected to preconditioning, real-time conditioning, and postconditioning.…”

Section: Introductionmentioning

confidence: 99%