YB-1 Knockdown Inhibits the Proliferation of Mesothelioma Cells through Multiple Mechanisms

Abstract

Y-box binding protein-1 (YB-1) is a multifunctional oncoprotein that has been shown to regulate proliferation, invasion and metastasis in a variety of cancer types. We previously demonstrated that YB-1 is overexpressed in mesothelioma cells and its knockdown significantly reduces tumour cell proliferation, migration, and invasion. However, the mechanisms driving these effects are unclear. Here, we utilised an unbiased RNA-seq approach to characterise the changes to gene expression caused by loss of YB-1 knockdown in three mesothelioma cell lines (MSTO-211H, VMC23 and REN cells). Bioinformatic analysis showed that YB-1 knockdown regulated 150 common genes that were enriched for regulators of mitosis, integrins and extracellular matrix organisation. However, each cell line also displayed unique gene expression signatures, that were differentially enriched for cell death or cell cycle control. Interestingly, deregulation of STAT3 and p53-pathways were a key differential between each cell line. Using flow cytometry, apoptosis assays and single-cell time-lapse imaging, we confirmed that MSTO-211H, VMC23 and REN cells underwent either increased cell death, G1 arrest or aberrant mitotic division, respectively. In conclusion, this data indicates that YB-1 knockdown affects a core set of genes in mesothelioma cells. Loss of YB-1 causes a cascade of events that leads to reduced mesothelioma proliferation, dependent on the underlying functionality of the STAT3/p53pathways and the genetic landscape of the cell.

YB‐1 regulates mesothelioma cell migration via snail but not EGFR, MMP1, EPHA5 or PARK2

“…YB-1 si-YB1 CDS [13]. Besides regulation of cell cyclerelated pathways, these data indicated a strong to moderate association with cell function terms including "Migration," "Invasion," "Movement," and "Cell-Cell Contact" as well as "Rho GTPase Signaling" and "Upstream Kinase EGFR" in all three cell lines.…”

“…The YBX1 ‐specific siRNAs si‐YB1 CDS (UUUGCUGGUAAUUGCGUGGAGGACC), si‐YB1 UTR (UAUUUCUUCUUGUUGGAUGACUAAA) and nonsilencing control siRNA (AAGCAACUUGGUAAGACUCGUGUGG) were purchased from GenePharma (Shanghai, China) and have been previously validated [ 10 , 13 ]. The siRNAs targeting EGFR and SNAI1 were obtained from Santa Cruz Biotechnology (Dallas, TX, USA).…”

“…Migration of single cells was manually tracked using imagej as previously described [ 13 , 15 ]. Specifically, cells (3 × 10 3 ) were seeded into 48‐well plates and, where indicated, treated with 100 ng·mL −1 doxycycline or 10 μ m erlotinib.…”

A Non-Genetic, Cell Cycle Dependent Mechanism of Platinum Resistance in Lung Adenocarcinoma

“…The VST is effective at stabilising variance, because it considers the differences in size factors, such as the datasets with large variation in sequencing depth (Love et al, 2014). Canonical Pathway analysis of known proliferation, cell cycle, migration and cell death-related signalling pathways were conducted using the Ingenuity Pathway Analysis software (QIAGEN), as previously described (Johnson et al, 2020). Briefly, minimum significance cut offs of p-value>0.05 and Z scores of >2 and <-2 were applied for pathways analysis.…”

Intricate crosstalk between MYB and noncoding RNAs in cancer

“…Interestingly, transcriptional regulators exert an enormous effect in modulating the expression of miRNA by targeting MYB. Y-box binding protein 1 (YB-1), a DNA and RNA-binding protein family member, is a multifunctional oncoprotein that plays a critical role in cell processes [ 52 , 53 ]. In laryngeal squamous cell carcinoma (LSCC), YB-1 induces miR-155 expression through MYB and promotes cancer development [ 54 ].…”