Modern people identify the concept of health and the impact of sports on life. The new coronavirus infection SARS-CoV-2 made significant adjustments to everyday student sports life. The purpose of the study: To study the impact of the new coronavirus infection SARS-CoV-2 on the physical health of students involved in professional and amateur sports. 110 students were examined, among them 62 undergraduates are professional athletes, and 48 undergraduates do amateur sports. Physical load was aerobic. Blood pressure was being measured. ECG, and the level of SaO2 were being recorded. The questionnaire was filled out using Google Forms. Statistical analysis was carried out using the Microsoft Office Excel 2017 software package and Google Forms. The results of the conducted functional examination methods for all students did not exceed the normal parameters. 39 undergraduates from 110 examined students (35.45%) experienced new coronavirus infection SARS-CoV-2. Students, who made the Gam-COVID-Vac vaccine, got ill statistically significantly less than students did without vaccination (29.76% versus 53.85%, p=0.025). We found out the certain correlation, which confirms the following. Students who do professional sports, have adverse reactions to vaccination (r=0.523; p=0.001), as well as they cope with the infection harder (r=0.370; p=0.001). In vaccinated professional athletes, the severity of the course of coronavirus infection was associated with the presence of adverse reactions to vaccination (r=0.320: p=0.016). The deterioration of physical fitness in the post-COVID period correlated with professional sports (r=0.389; p=0.016). Chest discomfort in professional athletes - smokers after infection was associated with the fact of smoking (r=0.221; p=0.014). Conclusions: Gam-COVID-Vac vaccination prevents SARS-CoV-2 new coronavirus infection in students, who do either professional or amateur sports. Professional athletes had weak toleration to Gam-COVID-Vac vaccination. In fact, if a student had adverse reaction to vaccination, he coped with the disease worse in case of infection. The deterioration in physical wellness after experienced coronavirus infection directly correlated with professional sports. Tobacco smoking worsens the course of the post-COVID period in professional athletes.

According global population aging there is an increase in the absolute and relative numbers of people in older age groups. Therefore, senile asthenia (SA) is very relevant. An association between SA and cardiovascular disease has been proven. In addition, there is an increase of aging anemia. At the same time, mortality in patients with anemia, including anemia, which is caused by cardiovascular diseases, increases. Purpose of the study: To study the association of anemia with cardiovascular pathology in patients who have SA syndrome. 168 over 65-year-old patients were examined. The main group contains 60 patients with SA syndrome (37 men, 23 women); control group includes 108 people (68 men, 40 women) without SA syndrome. The median age of patients in the main group did not statistically significantly differ from the median age of people in the control group (82 years ±7.4 [75.00; 84.00] years versus 78 years ±7.1 [65.00; 82.00] years, p=0.605). All patients had a comprehensive geriatric assessment (CGE). Statistically, anemia in patients with SA is diagnosed more frequently in comparison with patients without SA (51.67% vs. 33.33%, p<0.001). Statistically, significant negative correlations were determined among the hemoglobin level and senile asthenia (r=-0.222; p<0.001), hematocrit and senile asthenia (r=-0.224; p<0.001). There are statistically significant direct correlations between anemia in patients with SA with frequent supraventricular extrasystole (r=0.152; p=0.049) and frequent ventricular extrasystole (r=0.154, p=0.047). Conclusion: The association of SA with anemia was confirmed, whereas anemia in patients, who have SA syndrome, affects the occurrence of frequent supraventricular and frequent ventricular extrasystoles.

Ankylosing spondylitis is a chronic rheumatological disease of unknown etiology. The search for new genetic associations will improve understanding of pathogenesis. Objective: to study the association of the rs2569190 polymorphism of the CD14 gene with ankylosing spondylitis in the European population of the Krasnoyarsk region. The study recruited 3 groups of patients: the first - with ankylosing spondylitis (AS) (n = 150), the second group - patients with the rest of seronegative spondyloarthritis (SPA) (n = 66), the third group included conditionally healthy patients (control group) (n = 226). The clinical assessment of patients with SPA was based on Russian federal clinical guidelines, including the calculation of the BASDAI, BASFI and HAQ indices. DNA isolation was performed using the standard phenol-chloroform method. Genotyping for the CD14 gene was performed by PCR (polymerase chain reaction) – RFLP (restriction fragment length polymorphism) analysis. PCR was performed with a set of primers (forward GCTGAGGTTCGGAGAAGTTGC; reverse GGTGCCAACAGATGAGGTTCAC) followed by restriction with Bme18I. PCR products were analyzed by electrophoresis in 4% polyacrylamide gel followed by staining with ethidium bromide. Comparative analysis of the group of patients with AS and the control group revealed a statistically significant prevalence of the TT genotype rs2569190 in the main group (34.7% versus 23.9%) (p = 0.0236; OR 1.6901; 95% CI OR 1.0728-2.6625). Patients with seronegative SPA did not demonstrate the significant disparities in rs2569190. In Krasnoyarsk region europids, the TT genotype of the rs2569190 polymorphism was associated with ankylosing spondylitis but not with seronegative SPA. The identification of a new association confirms the influence of other genetic factors on the predisposition to AS. It is likely that some of the genetic factors play a role in the pathogenesis under the influence of the external environment. Identification of these associations will make it possible to adjust the lifestyle of patients and their relatives to reduce the risk of exacerbation or development of AS.