No abstract

No abstract

Source/Description: The polymorphic (TG)n repeat begins at the 10313 base pair of the human int-2 proto-oncogene locus on chromosome 1 1q13 (1). The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously (2). The predicted length of the amplified sequence was 167 bp. Primer Sequences: TTTCTGGGTGTGTCTGAAT (TG strand); ACACAGTTGCTCTAAAGGGT (AC strand).

A fourth histologically-confirmed American case of Creutzfeldt-Jakob disease (CJD) related to human growth hormone (hGH) therapy is reported. Like kuru, the illness was dominated by cerebellar signs and relatively little mental deterioration. The diagnosis was strongly supported premortem by the presence of two abnormal 30 kDa proteins in the CSF that are seen almost exclusively in CJD. The characteristic clinical picture coupled with such biochemical data allow a reasonably accurate premortem diagnosis of hGH-related iatrogenic CJD to be made.