INTRODUCTIONThe terpenoids constitute the largest family of natural products; over 22,000 individual compounds of this class have been described (Connolly and Hill, 1991), and the number of defined structures has doubled every decade since the 1970s (Devon and Scott, 1972;Glasby, 1982). The terpenoids play diverse functional roles in plants as hormones (gibberellins, abscisic acid), photosynthetic pigments (phytol, carotenoids), electron carriers (u biquinone, plastoquinone), mediators of polysaccharide assembly (polyprenyl phosphates), and structural components of membranes (phytosterols). In addition to these universal physiological, metabolic, and structural functions, many specific terpenoid compounds (commonly in the CIO, C15, and C20 families) serve in communication and defense, for example, as attractants for pollinators and seed dispersers, competitive phytoxins, antibiotics, and herbivore repellents and toxins (Harborne, 1991). Terpenoids available in relatively large amounts as essential oils, resins, and waxes are important renewable resources and provide a range of commercially useful products, including solvents, flavorings and fragrances, adhesives, coatings, and synthetic intermediates (Zinkel and Russell, 1989;Dawson, 1994). Members of the terpenoid group also include industrially useful polymers (rubber, chicle) and a number of pharmaceuticals (artemisinin, taxol) and agrochemicals (pyrethrins, azadirachtin).In spite of the economic significance of the terpenoids and their many essential functions, relatively little is known about terpenoid metabolism and its regulation in plants. There are severa1 reasons for this. An overwhelming problem with the terpenoids is their sheer number. A given plant may synthesize (and catabolize) many different terpenoid types (from C5 to C40 and higher) at different times and locations for many different purposes throughout the course of development. Because all terpenoids are produced by a common biosynthetic pathway, sophisticated control mechanisms must exist to ensure the production of appropriate levels of these often structurally complex compounds in the proper metabolic, developmental, and environmental context. Pathway elucidation for highly functionalized terpenoid metabolites is not trivial, and determining the enzymology of terpenoid metabolism has proven very challenging, both because relatively little enzymatic machinery is dedicated to terpenoid metabolism and because many of the reaction types involved (carbonium ion To whom correspondence should be addressed. mechanisms) are unlike those of primary metabolism of carbohydrates, proteins, and lipids. Moreover, the genetics (let alone the molecular genetics) of terpenoid metabolism are insufficiently developed to provide generally useful tools for examining control of metabolism at the cell, enzyme, transcript, or DNA levels. Of comparable significance is the paucity of suitable model systems for examining either the induced regulation of multiple terpenoid pathways or the developmental regulation of ...

The monoterpene cyclase limonene synthase transforms geranyl diphosphate to a monocyclic olefin and constitutes the simplest model for terpenoid cyclase catalysis. (-)-4S-Limonene synthase preprotein from spearmint bears a long plastidial targeting sequence. Difficulty expressing the full-length preprotein in Escherichia coli is encountered because of host codon usage, inclusion body formation, and the tight association of bacterial chaperones with the transit peptide. The purified preprotein is also kinetically impaired relative to the mixture of N-blocked native proteins produced in vivo by proteolytic processing in plastids. Therefore, the targeting sequence, that precedes a tandem pair of arginines (R58R59) which is highly conserved in the monoterpene synthases, was removed. Expression of this truncated protein, from a vector that encodes a tRNA for two rare arginine codons (pSBET), affords a soluble, tractable 'pseudomature' form of the enzyme that is catalytically more efficient than the native species. Truncation up to and including R58, or substitution of R59, yields enzymes that are incapable of converting the natural substrate geranyl diphosphate, via the enzymatically formed tertiary allylic isomer 3S-linalyl diphosphate, to (-)-limonene. However, these enzymes are able to cyclize exogenously supplied 3S-linalyl diphosphate to the olefinic product. This result indicates a role for the tandem arginines in the unique diphosphate migration step accompanying formation of the intermediate 3S-linalyl diphosphate and preceding the final cyclization reaction catalyzed by the monoterpene synthases. The structural basis for this coupled isomerization-cyclization reaction sequence can be inferred by homology modeling of (-)-4S-limonene synthase based on the three-dimensional structure of the sesquiterpene cyclase epi-aristolochene synthase [Starks, C. M., Back, K., Chappell, J., and Noel, J. P. (1997) Science 277, 1815-1820].

INTRODUCTIONThe terpenoids constitute the largest family of natural products; over 22,000 individual compounds of this class have been described (Connolly and Hill, 1991), and the number of defined structures has doubled every decade since the 1970s (Devon and Scott, 1972;Glasby, 1982). The terpenoids play diverse functional roles in plants as hormones (gibberellins, abscisic acid), photosynthetic pigments (phytol, carotenoids), electron carriers (u biquinone, plastoquinone), mediators of polysaccharide assembly (polyprenyl phosphates), and structural components of membranes (phytosterols). In addition to these universal physiological, metabolic, and structural functions, many specific terpenoid compounds (commonly in the CIO, C15, and C20 families) serve in communication and defense, for example, as attractants for pollinators and seed dispersers, competitive phytoxins, antibiotics, and herbivore repellents and toxins (Harborne, 1991). Terpenoids available in relatively large amounts as essential oils, resins, and waxes are important renewable resources and provide a range of commercially useful products, including solvents, flavorings and fragrances, adhesives, coatings, and synthetic intermediates (Zinkel and Russell, 1989; Dawson, 1994). Members of the terpenoid group also include industrially useful polymers (rubber, chicle) and a number of pharmaceuticals (artemisinin, taxol) and agrochemicals (pyrethrins, azadirachtin).In spite of the economic significance of the terpenoids and their many essential functions, relatively little is known about terpenoid metabolism and its regulation in plants. There are severa1 reasons for this. An overwhelming problem with the terpenoids is their sheer number. A given plant may synthesize (and catabolize) many different terpenoid types (from C5 to C40 and higher) at different times and locations for many different purposes throughout the course of development. Because all terpenoids are produced by a common biosynthetic pathway, sophisticated control mechanisms must exist to ensure the production of appropriate levels of these often structurally complex compounds in the proper metabolic, developmental, and environmental context. Pathway elucidation for highly functionalized terpenoid metabolites is not trivial, and determining the enzymology of terpenoid metabolism has proven very challenging, both because relatively little enzymatic machinery is dedicated to terpenoid metabolism and because many of the reaction types involved (carbonium ion To whom correspondence should be addressed. mechanisms) are unlike those of primary metabolism of carbohydrates, proteins, and lipids. Moreover, the genetics (let alone the molecular genetics) of terpenoid metabolism are insufficiently developed to provide generally useful tools for examining control of metabolism at the cell, enzyme, transcript, or DNA levels. Of comparable significance is the paucity of suitable model systems for examining either the induced regulation of multiple terpenoid pathways or the developmental regulation of ...

Fruit ripening is a developmental process involving a series of coordinated biochemical and physiological changes, leading to a soft edible fruit [2]. A number of specific mRNAs increase with ripening of mature avocado fruit [3]. Among these are the messages for cellulase [3], a cytochrome P-450 oxidase [ 1 ], and a small number of other genes, as yet unidentified [4,10]. In order to understand the function and regulation of ripening-related genes, we have analyzed the 1 CCCT TCCT T TTAGCTCC~TGA~TA~AAT~TGAAAGAGAGAGATGGATT~CTT~AG.ICATTAA~ATr~GAGAAACTTGAGGGCCAAGAGAGAGCGG~C

No abstract