No abstract

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5′-CCTCCGCGGATGCTAACTT-3′ and CMV-R 5′-CGGAATCAGACTGGGAGCA-3′) and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

Tomato torrado virus (ToTV) is a recently identified Picorna-like virus that causes “torrado disease” in tomatoes (4). Typical symptoms of “torrado disease” seen in tomato crops (Solanum lycopersicum L. formerly Lycopersicon esculentum L.) were initially defined as yellow areas at the base of the leaflet that later developed into necrotic spots that sometimes abscised, leaving holes in the leaflet. Other plants showed extensive necrosis progressing from the base to the tip of the leaflet. Fruits were distorted with necrotic lines on the surface that often cracked. Affected plants had a burnt-like appearance and the production was seriously reduced. These symptoms have been observed in tomato crops in Murcia (Spain) and the Canary Islands (Spain) (1). To identify possible alternative hosts that may serve as virus reservoirs, samples of 72 different common weed species were collected in greenhouses in Murcia and the Canary Islands where “torrado disease” symptoms were observed in tomatoes. Forty-seven showed virus-like symptoms and 25 were asymptomatic. Symptoms included mild mosaic, blistering, vein clearing, interveinal yellowing, yellow spots, necrosis, leaf distortion, and curling. Samples were analyzed by one-step reverse transcription (RT)-PCR using primers specific for ToTV to amplify 580 bp of the polyprotein region of RNA2 (3) and dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the same portion of the ToTV genome. Twenty-two of the 72 weed samples belonging to Amaranthus sp. (Amaranthaceae); Spergularia sp. (Caryophyllaceae); Atriplex sp., Chenopodium ambrosioides L., Chenopodium sp., and Halogetum sativus (Loef. ex L.) Moq. (Chenopodiaceae); Senebiera didyma Pers. (Cruciferae); Malva sp. (Malvacae); Polygonum sp. (Polygonaceae); and Nicotiana glauca Graham and Solanum nigrum L. (Solanaceae) were positive for ToTV by molecular hybridization (10 samples) and RT-PCR (22 samples, including the samples positive by molecular hybridization). PCR products obtained from Atriplex sp. (Canary Islands) and S. didyma (Murcia) were sequenced (GenBank Accessions EU090252 and EU090253). BLAST analysis showed 99% identity to ToTV RNA2 sequence (GenBank Accession DQ388880). Two tomato plants were positive for ToTV by RT-PCR after mechanical back-inoculation, although no symptoms were observed. This study showed ToTV infects common weeds present in Spanish tomato crops. Recently, Trialeurodes vaporariorum has been reported to transmit ToTV (2), although the efficiency of transmission is unknown. The vector-assisted transmission of ToTV could explain the infection of weeds in affected greenhouses. To our knowledge, this is the first report of natural infection of weeds by ToTV. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (3) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization WO/2006/085749, 2006. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

Transmission of Pepino mosaic virus by the Fungal Vector Olpidium virulentus A Ana na A Alfaro lfaro-F -Fernandez erná ndez, , M Marıa aría del del C Carmen armen C Cordoba ó rdoba-S -Selles ellés, , J Jose osé A Á ngel ngel H Herrera errera-V -Vasquez á squez, , M Marıa del aría del C Carmen armen C Cebrian ebriá n and and C Concepcion oncepció n J Abstract Transmission of Pepino mosaic virus (PepMV) by the fungal vector Olpidium virulentus was studied in two experiments. Two characterized cultures of the fungus were used as stock cultures for the assay: culture A was from lettuce roots collected in Castello´n (Spain), and culture B was from tomato roots collected in Murcia (Spain). These fungal cultures were maintained in their original host and irrigated with sterile water. The drainage water collected from irrigating these stock cultures was used for watering PepMV-infected and non-infected tomato plants to constitute the acquisition-source plants of the assay, which were divided into six different plots: plants containing fungal culture A (non-infected and PepMV-infected); plants containing fungal culture B (non-infected and PepMVinfected); PepMV-infected plants without the fungus; and plants non-infected either with PepMV and the fungus. Thirty-six healthy plants grouped into six plots, which constituted the virus acquisition-transmission plants of the assay, were irrigated with different drainage waters obtained by watering the different plots of the acquisition-source plants. PepMV was only transmitted to plants irrigated with the drainage water collected from PepMV-infected plants whose roots contained the fungal culture B from tomato with a transmission rate of 8%. No infection was detected in plants irrigated with the drainage water collected from plots with only a fungus or virus infection. Both the virus and fungus were detected in water samples collected from the drainage water of the acquisitionsource plants of the assay. These transmission assays demonstrated the possibility of PepMV transmission by O. virulentus collected from tomato crops.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5′ GATGAAGCTGAACAACATTTC 3′ and PepTGB-R: 5′ GGAGCTGTATTRGGATTTGA 3′). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.