DNA fingerprinting of Mycobacterium tuberculosis has been shown to be a powerful epidemiologic tool. We propose a standardized technique which exploits variability in both the number and genomic position of IS6110 to generate strain-specific patterns. General use of this technique will permit comparison of results between different laboratories. Such comparisons will facilitate investigations into the international transmission of tuberculosis and may identify specific strains with unique properties such as high infectivity, virulence, or drug resistance.

A segment of DNA repeated in the chromosome of Mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction (PCR). The sequences of the primers (5' to 3') were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG, and a temperature of 68 degrees C was used for annealing the primers in the reaction. Amplification produced a 123-base-pair fragment with an internal SalI site. The specific PCR product was obtained with input DNA from 11 different strains of M. tuberculosis and Mycobacterium bovis and one strain of Mycobacterium simiae. No product was detected with DNA from 28 strains of the Mycobacterium avium complex, Mycobacterium scrofulaceum, Mycobacterium kansasii, Mycobacterium fortuitum, Mycobacterium chelonei, and Mycobacterium gordonae. The PCR product was detected by gel electrophoresis after 30 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for an assay to detect M. tuberculosis directly in clinical material.

Multidrug-resistant tuberculosis is readily transmitted among hospitalized patients with AIDS. Physicians must be alert to this danger and must enforce adherence to the measures recommended to prevent nosocomial transmission of tuberculosis.

No abstract