Meloidogyne enterolobii, commonly known as guava root-knot nematode, poses risk due to its widespread distribution and extensive host range. This species is recognized as the most virulent root-knot nematode (RKN) species because it can emerge and breed in plants that have resistance to other tropical RKNs. They cause chlorosis, stunting, and yield reductions in host plants by producing many root galls. It is extremely challenging for farmers to diagnose due to the symptoms’ resemblance to nutritional inadequacies. This pathogen has recently been considered a significant worldwide threat to agricultural production. It is particularly challenging to diagnose a M. enterolobii due to the similarities between this species and other RKN species. Identified using traditional morphological and molecular techniques, which is a crucial first in integrated management. Chemical control, biological control, the adoption of resistant cultivars, and cultural control have all been developed and effectively utilized to combat root-knot nematodes in the past. The object of this study was to get about the geographical distribution, host plants, symptoms, identification, and control techniques of M. enterolobii and recommend future initiatives to progress its management.

Copperleaf (Acalypha australis; Euphorbiaceae), widely cultivated in China, is a traditional Chinese herbal medicine that is used for clearing heat and detoxifying, astringency and hemostasis (Zhang and Zhang 1994). In September 2021, wild Asian copperleaf plants showed leaf yellowing in a corner outside a greenhouse (22°50′ N; 108°17′ E), Guangxi Province, China. Galls and egg masses were observed on the plant roots on approximately 60% of plants. Females and second-stage juveniles (J2) were dissected and extracted from roots with galls. The perineal pattern of females was dorsal-ventrally oval with low and round dorsal arches, lacking clear lateral lines. Morphological measurements of females (n=20; mean ± standard error) were body length (BL) 697.7 ± 17.3 μm, maximum body width (BW) 521.5 ± 18.3 μm, stylet length 14.8 ± 0.3 μm, and dorsal pharyngeal gland orifice to stylet base (DGO) 5.1 ± 0.2μm. J2s (n = 20) were vermiform, had a slender tail, with a tapering to rounded tip with distinct hyaline region at the tail terminus and had the following morphological measurements: BL 475.5 ± 32.7 μm, BW 16.7 ± 0.6 μm, stylet length 14.4 ± 1.4 μm, DGO 3.9 ± 0.1 μm, hyaline tail length 18.0 ± 0.6 μm, and tail length 50.1 ± 1.2 μm. These morphological characteristics fit the description for Meloidogyne enterolobii (Yang and Eisenback 1983). In order to confirm species identification, genomic DNA was extracted from 12 single J2 (Luo et al. 2020). Species identity was further explored by the rDNA-internal transcribed spacer (ITS) region using primers V5367/26S (Vrain et al. 1992), and the D2–D3 fragment of the 28S ribosomal RNA gene using primers D2A/D3B (De Ley et al. 1999). The sequences for the target genes were 733 bp (GenBank accession no. OM168996) and 734 bp (GenBank accession no. OM177195), respectively. Homologies were 99 to 100% identical with those in GenBank for known sequences of M. enterolobii. Furthermore, species identification was confirmed using PCR to amplify a portion of the rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (Long et al. 2006). Koch’s postulates was tested in a greenhouse at 25 to 28˚C temperature. Eggs were multiplied on tomato in the greenhouse using a single egg mass hand-picked from originally natural infected A. australis roots. Fifteen A. australis seedlings maintained in 14.5-cm diameter and 10-cm high pots containing autoclaved sandy soil (sand/soil = 3:1), one seedling/pot, inoculated with 5,000 eggs/plant, and five noninoculated seedlings were used as controls. After 60 days, all inoculated plants showed galling root symptoms and the control plants displayed no symptoms. The reproduction factor (Rutter et al. 2021) on A. australis was 4.3. Furthermore, the morphological and molecular characterization of the nematode was identical to the original samples. To our knowledge, this is the first report of M. enterolobii infecting Asian copperleaf that is cultivated in 29 provinces/regions of China. The growers should be aware of this nematode and take measures to avoid spread and serious economic losses.

Sweet potato (Ipomoea batatas Lam.) is the seventh most widely cultivated food crop in the world and the sixth most widely cultivated food crop in China. In June 2021, sweet potato plants were found to be displaying nutrient deficiencies with red leaves in a sweet potato field in Hepu County, Beihai City, Guangxi Province (21°37′43.41"N，109°10′58.74"E). Black irregular protuberant scars on tubers and nodular galls on roots were found. Thirty-five sweet potato ‘Variety Guiziweishu No. 1’ tubers were randomly collected and 97% were infected with root-knot nematodes. Females (n = 20) had perineal patterns that were oval, with moderate to high dorsal arches, the lateral field was not obvious or absent. Morphological measurement of females (n = 20) were made from micrographs taken with a microscope (Axio Imager, Z2, ZEISS). Measurements (mean + standard error) were: body length (BL) = 932.8 ± 18.4 μm; maximum body width (BW) = 588.8 ± 22.0 μm; vulval slit length = 19.6 ± 0.6 μm; and, vulval slit to anus distance = 22.3±0.8 μm. Morphological measurements of second-stage juveniles (J2; n = 20) were: BL =512.0± 5.9 μm; BW = 17.4 ± 0.6 μm; Stylet length = 13.4 ± 0.2 μm; dorsal pharyngeal gland orifice to stylet base (DGO) =3.4 ± 0.0 μm; and, hyaline tail length = 17.6 ± 0.5 μm. These morphological characteristics fit those of the original description for Meloidogyne enterolobii (Yang and Eisenback 1983). Molecular analyses were conducted to confirm species identification. Genomic DNA was extracted from 12 single J2 (Luo et al. 2020). The rDNA-internal transcribed spacer (ITS) region was sequenced using primers V5367/26S (5′-TTGATTACGTCCCTGCCCTTT-3′/5′-TTTCACTCGCCGTTACTAAGG-3′) (Vrain et al. 1992), and the D2–D3 fragment of the 28S rRNA genes using primers D2A/D3B (5′-GTACCGTGAGGGAAAGTTG-3′/5′-TCGGAAGGAACCAGCTACTA-3′) (De Ley et al. 1999). The target gene sequences were 733 bp (GenBank accession no. MZ413814) and 733 bp (MZ411468), respectively; they were all 99-100% similar to those of M. enterolobii sequences available in the GenBank. Species identification was also confirmed using PCR to amplify rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (5′-AACTTTTGTGAAAGTGCCGCTG-3′/5′-TCAGTTCAGGCAGGATCAACC-3′). The electrophoresis results showed a bright band (∼200 bp) only in the lane with the M. enterolobii-specific primers, similar in size to that previously reported for M. enterolobii (Long et al. 2006). Therefore, this Meloidogyne sp. population on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. To verify the pathogenicity of nematodes, sweet potato ‘Variety Guiziweishu No. 1’ seedlings were individually planted in 18 cm diameter, 11 cm deep plastic pots containing 1000 cm3 autoclaved sandy soil (sand/soil = 3:1). A total of 15 seedlings were inoculated with 10,000 eggs (the population was same with nematode population in soil the field) and 5 seedlings without eggs were used as a control. Plants were maintained at 25-28°C in a greenhouse. After 2 months, root of inoculated plants exhibited elongated swellings similar to symptoms observed in the field. The noninoculated plants did not have any galls or swelling. A reproduction factor (nematode final population density/initial population density) value of 18.6 was obtained. These results confirmed the nematodes’ pathogenicity. To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in Guangxi Province. In 2014, the nematode on sweet potato was reported in Guangdong Province (Gao et al. 2014). Guangxi Province is the largest producer of sweet potato in south China and is the third top producing region in the whole country. Meloidogyne enterolobii is a potential risk to the production of sweet potato in this region, and control measures are needed to prevent any further spread.

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43′38″ N, 108°18′06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.