Jembrana disease virus (JDV) is a viral pathogen that causes Jembrana disease in Bali cattle (Bos javanicus) with high mortality rate. An easy and rapid diagnostic method is essential for further control this disease. We used a reverse transcription loop-mediated isothermal amplification (RT-LAMP) combined with lateral flow dipstick (LFD), based on conserved tm subunit of Jembrana disease virus env gene. The RT-LAMP conditions were optimized by varying the concentration of MgSO 4 , betaine, dNTP, and temperature as well as the time and duration of reaction. The primers sensitivity for JDV was confirmed. The method was able to detect env-tm gene dilution which contained 2 9 10 -15 g of template. Comparatively, the sensitivity of RT-LAMP/LFD was 100-fold more sensitive than reverse transcription-polymerase chain reaction. The primers specificity for JDV was also confirmed using positive and negative controls. This work also showed that virus detection could be done not only on total RNA extracted from blood but various organs could also be analyzed for the presence of JDV using RT-LAMP/LFD method. The whole process, including the LAMP reaction and the LFD hybridization step only lasts approximately 75 min. Results of analysis can be easily observed with naked eyes without addition of any chemical or further analysis. The combination of RT-LAMP with LFD makes the method a more suitable diagnostic tool in conditions where sophisticated and expensive equipments are not available for field investigations on Jembrana disease in Bali cattle.

Lateral flow assay (LFD) based nucleic acid lateral flow (NALF)  method has been developed recently. The method met point of care testing (POCT) as simple and rapid procedures, less equipment, and can be performance by less skilled technician. NALF based on nucleic acid hybridizationis  more economical then immunochromatography assay which use antibody-antigen recognition. Cross hybridization has issued while used to differentiate organism with high GC content and high homology as high similarity genome. Some techniques has applied to give high stringency condition avoid cross hybridization reaction but need more procedure to apply. We found glycerol applied to buffer assay could reduce cross hybridization on nitrocellulose membrane. The study used 2 kinds of high stringency buffer as PBS and SSC bases and high concentration of ssDNA amplicon as sample. Without glycerol ingredient gave cross hybridization signal on test line. But used glycerol could reduce those even omitted with PBS based buffer assay. Beside those, glycerol could significantly increased hybridization signal in SSC based buffer assay (p<0.05).

Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus;  hybridization; nucleic acid lateral flow; serotyping

No abstract

BACKGROUND: One of the keys to stunting reduction, a condition of lower height or length compared to their age, is the measurement of children in the community. However, the infantometer as the gold standard is not accessible by all community health workers (CHWs). AIM: The aim is to develop a stunted early detection tool (SEDT) for Indonesian children under-two years old. MATERIALS AND METHODS: This qualitative study was conducted as the first phase of the development process and focused on the experts’ judgments of the prototype. Experts’ judgments were recorded qualitatively. There were five in-depth interviews with anthropometric, health promotion, and media design experts. Rogers’ Diffusion of Innovations Theory and thematic content analysis were used to analyze the relative advantages, compatibility, complexity, and observability. RESULTS: The prototype of the SEDT consists of two tools, including a length mat to measure children’s length and a circular disc that helps CHWs classify the nutritional status of the children according to length for age length-for-age Z-score. Most experts agreed that the SEDT is a good instrument for the early detection of stunting among children under 24 months. The tool is designed to be portable, child-friendly, compatible, and easy to use. Although its development has the potential to help CHWs fulfill their responsibilities, major changes were needed specifically to improve the tool’s stability and design. CONCLUSIONS: This analysis gives broad information about the SEDT’s potential as a SEDT considering its relative advantages, complexity, compatibility, and observability. Further research is important to validate potential users’ responses in a representative population.