Красноярская межрайонная клиническая больница №20 имени И. С. Берзона, Красноярск 660123, Российская Федерация Резюме. В современной медицине достаточно актуальной является проблема диагностики и лечения пациентов с хроническим болевым синдромом. В качестве эффективной меры по решению данной проблемы была выдвинута идея организации сети центров лечения боли. Международная Ассоциация Изучения Боли выделяет 4 уровня оказания помощи больным с хронической болью, различающихся по набору и уровню сложности оказываемой помощи. В данной статье подробно рассмотрена организация сети центров боли на примере испанской системы здравоохранения, как одной из прогрессивно развивающихся в этом направлении стран. Описаны принципы устройства, набор предоставляемой помощи на каждом из уровней оказания помощи. Кроме того, обращается внимание на принципы междисциплинарного взаимодействия, разработки тактики лечения и организации работы с пациентом, обратившимся в центр боли. Так же приведен пример работы центра боли на базе многопрофильного стационара в России. Ключевые слова: боль, хроническая боль, центр лечения боли, интервенционная медицина, интервенционные методы, лечение боли, неонкологическая боль. Конфликт интересов. Авторы декларируют отсутствие явных и потенциальных конфликтов интересов, связанных с публикацией настоящей статьи.

Ankylosing spondylitis is a chronic rheumatological disease of unknown etiology. The search for new genetic associations will improve understanding of pathogenesis. Objective: to study the association of the rs2569190 polymorphism of the CD14 gene with ankylosing spondylitis in the European population of the Krasnoyarsk region. The study recruited 3 groups of patients: the first - with ankylosing spondylitis (AS) (n = 150), the second group - patients with the rest of seronegative spondyloarthritis (SPA) (n = 66), the third group included conditionally healthy patients (control group) (n = 226). The clinical assessment of patients with SPA was based on Russian federal clinical guidelines, including the calculation of the BASDAI, BASFI and HAQ indices. DNA isolation was performed using the standard phenol-chloroform method. Genotyping for the CD14 gene was performed by PCR (polymerase chain reaction) – RFLP (restriction fragment length polymorphism) analysis. PCR was performed with a set of primers (forward GCTGAGGTTCGGAGAAGTTGC; reverse GGTGCCAACAGATGAGGTTCAC) followed by restriction with Bme18I. PCR products were analyzed by electrophoresis in 4% polyacrylamide gel followed by staining with ethidium bromide. Comparative analysis of the group of patients with AS and the control group revealed a statistically significant prevalence of the TT genotype rs2569190 in the main group (34.7% versus 23.9%) (p = 0.0236; OR 1.6901; 95% CI OR 1.0728-2.6625). Patients with seronegative SPA did not demonstrate the significant disparities in rs2569190. In Krasnoyarsk region europids, the TT genotype of the rs2569190 polymorphism was associated with ankylosing spondylitis but not with seronegative SPA. The identification of a new association confirms the influence of other genetic factors on the predisposition to AS. It is likely that some of the genetic factors play a role in the pathogenesis under the influence of the external environment. Identification of these associations will make it possible to adjust the lifestyle of patients and their relatives to reduce the risk of exacerbation or development of AS.

Activity in the student scientific society (SSC) during higher education is an important factor that affects both the quality of specialist training and the success of their continuous personal and professional development. However, the interest of the majority of students in self-education and work in SSS is relatively low. The problem of involving a medical student in the scientific environment is particularly relevant in the modern social context, which is characterized by the young generation's fascination with the virtual world, which often leads to the development of infantile behavior, inability to independently and clearly plan immediate goals and ways to implement them, and lack of readiness for effective communication in the real world of the medical profession. The purpose of the study was to assess the potential and identify the ways of motivation and the optimal organization of medical students’ research activity as their personal and professional growth driver. The objectives of the study included: a) identification of the main factors motivating students to engage in scientific activities; b) assessment of the association between, on the one hand, the participation of students in the work of the Student Research Society and, on the other hand, the level of their academic achievement and overall personal development; c) search for effective ways to organize students' research work. The study was carried out on the basis of an autonomy-oriented approach which prioritizes a self-determined continuous personal and professional development. As part of the study, a survey was conducted among 230 fifth and sixth-year medical students of Professor V.F. Voino-Yasenetsky Krasnoyarsk State Medical University. Statistical data processing was carried out using the application package EXCEL and STATISTICA FOR WINDOWS 10.0. The results of the study indicate that participating in the work of the Student Research Society is an important factor in the personal and professional development of medical students, helping to increase their academic performance, improve the quality of knowledge mastering, develop the basis for students’ clinical thinking, inspire their interest in continuous personal and professional development as well as ensure their successful self-realization in the medical profession. It was revealed that continuous personal and professional development requires students to have a certain level of research competence, which is based on their educational research autonomy. It has been established that the most important conditions for medical students’ personal and professional development in research activities are ensuring their research orientation, fostering their personal involvement into research work and enriching their research expertise based on the autonomy-oriented approach. Specific activities are underlined that allow for the implementation of the conditions of students’ personal and professional development in research work and autonomization of the university educational environment.