Bovine trophoblast protein-1 (bTP-1) is a 172-amino acid interferon- alpha that has a role in maternal recognition of pregnancy in cattle. Here we describe production of bTP-1 by recombinant procedures in Escherichia coli. A bTP-1 gene was constructed which lacked the codons representing the signal sequence and provided a Met initiation codon ahead of the TGT codon encoding Cys1 of the mature protein. This construct was placed under the control of the Trp promoter within the expression vector pTrp2. Expression occurred optimally in E. coli D112 in the absence of tryptophan and in the presence of 0.5% acid-hydrolyzed casein (casamino acids) when 0.5 mM indole acetic acid was included in the medium. The bTP-1 was deposited in inclusion bodies and accounted for as much as 27% of the total cellular protein. The inclusion bodies were isolated by differential centrifugation and washed. The bTP-1 was solubilized by use of guanidinium-HCI and 2-mercaptoethanol and allowed to renature in air. Final purification was achieved by anion exchange chromatography on DEAE-cellulose. The yield of purified product, which had an antiviral activity greater than 10(8) international reference units/mg, was approximately 20 mg/liter. The recombinant bTP-1 was relatively stable to freeze-thawing and frozen storage, and could induce the production of an acidic protein of 70,000 mol wt in cultured explants of endometrium prepared from ewes on day 13 of the estrous cycle. The latter protein is a characteristic product of interferon-alpha action on uterine tissue.(ABSTRACT TRUNCATED AT 250 WORDS)

Aim: To assess the effect of triamcinolone acetonide and preservative vehicle formulations on human retinal pigment epithelium (ARPE19) cells over a range of concentrations. Methods: Triamcinolone acetonide, in its trade and preservative free formulations, along with the preservative vehicle were added to ARPE19 cell cultures in various concentrations (0.01-1.0 mg/ml). Cell viability was assessed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay at day 5 after exposure. Functionality of the cultured ARPE19 cell line was confirmed by exposure to a previously characterised toxic agent, tamoxifen. Results: The ARPE19 cell line behaved as predicted with exposure to tamoxifen. All formulations caused significant reductions in ARPE19 cell viability at the highest concentrations (1.0 mg/ml for triamcinolone preparations and undiluted vehicle). Cell viability was reduced to the greatest degree in trade formulation triamcinolone, less so by the vehicle, and least by preservative free triamcinolone. At lower concentrations no significant effect on cell viability was observed, although cell viability was found to be inversely proportional to increasing concentration of all tested reagents Conclusions: Both the trade and preservative free formulations of triamcinolone acetonide as well as the vehicle result in cell loss at in vitro concentrations of 1 mg/ml. Although this represents theoretical vitreous concentrations achieved with current widespread therapeutic use it probably does not indicate the actual exposure of cells in their biological milieu. That cell viability was reduced most in the trade formulation suggests a possible potentiated inhibitory toxic effect of triamcinolone acetonide and vehicle at higher concentrations.

Interferon-tau (IFN-tau), a type I IFN structurally related to IFN-alpha, is regarded as the major antiluteolytic factor secreted by the conceptus of ruminant ungulate species before definitive trophoblast attachment and implantation. It mediates its effects by acting on the uterine endometrium, where it blunts the normal pulsatile production of PGF2alpha, presumably as a result of its binding to type I IFN receptors. In this study, we describe the complementary DNAs for the two known subunits, IFNAR1 and IFNAR2, of this receptor isolated from bovine and ovine endometrial complementary DNA libraries by homology cloning. Although there is extensive inferred amino acid sequence similarity between bovine and ovine IFNAR1 (92% identity) and between bovine and ovine IFNAR2 (88% identity), they have diverged extensively from the human receptor subunits (approximately 67% and approximately 58% identity, respectively). Despite these differences in primary structure, the respective subunits from all three species are organized similarly in their extracellular and cytoplasmic regions, and the bovine and ovine subunits have each retained a number of polypeptide motifs implicated in signal transduction. These uterine receptors also appear not to be splice variants. The cloned ovine IFNAR1 subunit, for example, possesses the expected four extracellular SD100 domains of full-length bovine and huIFNAR1, and only the homologs of the so-called long form (huIFNAR2c) of human IFNAR2 have so far been identified. RT-PCR procedures indicate that the messenger RNA for both subunits are found, not only in endometrium, but in all other tissues examined except those ofpreimplantation conceptuses, which presumably cannot respond to the IFN-tau they produce. Quantitative RNase protection assays of ovine endometrial RNA show that the expression of neither subunit changes greatly during the estrous cycle or pregnancy. These data suggest that the type I IFN receptor, which is expressed by the endometrium and binds IFN-tau, is probably not a structurally unusual form.

EMBL accession nos X56341-X56346 (incl.) Recently a novel group of interferons (IFN) 172 amino acids in length and structurally related to the IFN-a family have been shown to be products of the trophoblast of certain ruminant species. They are important in triggering maternal responses to the presence of the peri-implantation stage conceptus in the uterus (1). Here, the cDNA representing six distinct mRNA for ovine trophoblast IFN have been cloned from a day 15-16 sheep conceptus library. The procedures were based on those described previously for the isolation of a single full-length clone (2). The data reveal two distinct types of cDNA (a-type and b-type) and support previous evidence that the ovine trophoblast IFN belong to a multigene family. The a-type provides a potential site of N-glycosylation at codon 101 (asn78), similar to the one on the cDNA for bovine trophoblast IFN (3). However, unlike bovine trophoblast IFN (4), ovine trophoblast IFN is not known A ACCTGAAGGTTCCCCCTGACCCCATCTCAGCCAGCCCAGCAGCAGCCGCATCTTCCCC to be glycosylated. The b-type does not possess a potential site for N-glycosylation.