The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.7 0 C. The repeatability analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency value of 206 %. These figures confirm that the method employed in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.

Research of radical scavenging activity of sambiloto (Andrographis paniculata Nees) and patikan kebo (Euphorbia hirta L) ethanolic extracts and their combination toward 2,2-Diphenyl-1-Picrylhidrazyl (DPPH) has conducted. Subjects of this experiment comprise sambiloto ethanolic extract, patikan kebo ethanolic extract, dechlorophyllated extract of sambiloto and combinations among those three. Dechlorophyllation by electrocoagulation method is done to reduce chlorophyll content thereby increasing the level of active compound in the sambiloto extract. The results of dechlorophyllation showed that only total flavonoid content in the extract of sambiloto increased, meanwhile the radical scavenging activity results showed that patikan kebo ethanolic extract has the lowest IC50 value (22,36 µg/mL) compared to sambiloto ethanolic extract (IC50 value 499,03 µg/mL). Extract combination may increase DPPH radical scavenging activity of the sambiloto extract (IC50 value 76,06 µg/mL) but not higher than that of patikan kebo single extract.

Accumulation lipid peroxidation can lead to the formation of malondialdehyde to generatefree radicals. Antioxidant will minimize free radical related health problems, such as naturalantioxidant from meat of kepel (Stelechocarpus burahol) (Blume) Hook. F. & Thompson) fruits.Antioxidant activities of methanol extracts and acetate ethyl fractions meat of kepel fruits calculatedprofile of malondialdehyde concentration (ng/mL) in CCl4 induced acute liver toxicity in femaleSprague Dawley rats using ELISA competitively method. All of groups induced CCl4 i.p. at 0 h, exceptuntreated and solvent control group, then vitamin C , methanol extracts and acetate ethyl fractionsp.o. once daily for 72 h. Identification of secondary metabolite was using phytochemical screeningand Thin Layer Chromatography (TLC). Liver weighed and calculated relative organ weight (ROW)of liver, then all of data analyzed using statistic tests, One Way ANOVA and Kruskall Wallis. Thisstudy showed methanol extracts can decrease MDA concentration, ALT and AST were more potent(significantly p<0.05) than acetate ethyl fractions and vitamin C. The TLC analysis identified methanolextracts have same polarity with quercetin (Rf = 0,26) and acetate ethyl fractions showed otherflavonoid class, except rutin and quercetin. ROW of acute liver toxicity in rats increased significantlyin CCl4 and vitamin C groups.