994). 13. A PCR processes were performed on a Perkn-Elmer GeneAmp PCR system 9600 macnne. For POA processng, 4 pmol of each DNA fragment and 2 unts of A m p T a q DNA polymerase, Stoffel fragment (Perkn-Elmer) In PCR buffer 110 m M trs-HCI, 50 mM KCI, 2.2 m M MgCl,. 0.8 m M deoxynucleotlde trlpnosphate (dNTP). pH 8.3, at 25"CI to a total volume of 40 i*. were processed for 40 cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 30 s). For general PCR. 0.2 i*.l of template sou t o n . 20 pmol of prmers. and 2 unts of Taq DNA polymerase (Gbco-BRL) In PCR buffer [50 m M KCI, 10 m M trls-HCI, 2 mM MgCl,, 10 m M (NH4),S04, 0 8 m M dNTP. pH 8.8, at 2S0C] to a volume of 40 pl were processed for 25 cycles (94°C for 30 s, 65°C for 30 s. and 72°C for 30 s). 14 T i e restrcton enzyme dgest operaton was conducted follow~ng the protocol of New England Boabs.15 T i e mutageness process followed standard protocols (20). (I) \.We added a tall to the ends of answer DNA that IS iomologous (complementary) to parts of M I 3 pnage DNA. PCR v11ti s p e c a y desgned prmers was a p p e d for t n s purpose. One prmer conslsted of 12-bp DNA homologous to M I 3 piage DNA (posltlons 6269 to 6280) and 15 bp of PC (GCT-GGAGCTCCACGTAGAATTCTGCGA); tne other prmer conssted of 12-bp DNA complementary to Mlapnage DNA (postons 6375 to 6386) and 15 bp of P, (GAATTGGGTACCCTGGATCCCGCCC). The frst prmer was phosphoryated at the 5 ' end ~11th T4 polynucleot~de knase (New England Boabs). ( I ) Tne dsDNA of the PCR souton In step (I) was dgested by X exonucease (Gbco-BRL) follow~ng the s u p per's nstructons. The DNA strand that contans a 5 ' piosphate was ihus dgested. ( I ) Mutagenetc M13 pnage DNA (contanng answer DNA) was syntneszed usng the ssDNA from step ( I ) as prmer and wd-type M I 3 pnage DNA as template 16. Transfecton, piage purfcaton, and DNA extracton were conducted follow~ng standard protocols (20).T i e DNA sequencng was done by tne Rockefeller Unvers~ty Proten/DNA Tecinoogy Center 17. The DNA In t i e data pool was purlfled by etianol precptaton, T i e ssDNA was dgested In S1 nucease buffer (50 m M N&c. 280 m M NaCI. and 4.5 m M ZnSO,) v11ti 2 unts of S1 nucease at room temperature for 2 mln 18. K. A. Eckert and T. A. Kunke. PCR veth hods Appl.

The synthesis and structural analysis of a library containing 13 taper- and conical-shaped self-assembling dendrons, 16 dendritic monomers, and their corresponding polymers is reported. Fifteen of these polymers exhibit a well-defined cylindrical shape produced by the self-assembly of their dendritic side groups that self-organizes in a hexagonal columnar two-dimensional liquid crystalline lattice. The retrosynthetic analysis of this lattice by X-ray diffraction (XRD) showed that the diameter (60 to 41 Å) and the number of repeat units forming the cylinder cross-section (7 to 1.9) of these polymers are determined by the structure of their dendritic side groups. This demonstrates that, in the hexagonal columnar lattice, the conformation (from helical to fully extended) and the stiffness of the polymer backbone penetrating through the center of the cylinder are controlled in a systematic and predictive way by the structure of the side groups. Dynamic and static light-scattering experiments have demonstrated the same trend for the stiffness of these polymers in solution (Kuhn segment length from 200 to 1032 Å). Single chains and monolayers of these polymers were visualized and quantitatively analyzed by scanning force microscopy (SFM) on a graphite surface to provide the first comparative study of the conformation, stiffness, and contour length in solution (by light scattering), in the disordered solid state on a flat substrate (by SFM), and in the hexagonal columnar lattice (by XRD). The elaboration of this library of visualizable cylindrical macromolecules with controlled chain conformation and stiffness accesses the elucidation of many fundamental problems of the field of polymer science at the molecular level and the design of multifunctional nanoscale systems based on single polymer chains.

In 1989, it was predicted that a change in dendritic shape to a nearly spherical one should occur upon increasing the generation number (Naylor, A. M.; Goddard, W. A., III; Kiefer, G. E.; Tomalia, D. A. J. Am. Chem. Soc. 1989, 111, 2339). The absence of long-range order required for X-ray analysis allowed only indirect evidence to be provided for this concept. This publication reports the synthesis of three generations of self-assembling monodendrons based on the AB3 building block methyl 3,4,5-trihydroxybenzoate. The first 3,4,5-tris[p-(n-dodecan-1-yloxy)benzyloxy]benzoic acid and the second-generation methyl 3,4,5-tris{3‘,4‘,5‘-tris[p-(n-dodecan-1-yloxy)benzyloxy]benzyloxy}benzoate monodendrons self-assemble into cylindrical supramolecular dendrimers that self-organize in a two-dimensional p6mm lattice. The third-generation monodendron 3,4,5-tris(3‘,4‘,5‘-tris{3‘‘,4‘‘,5‘‘-tris[p-(n-dodecan-1-yloxy)benzyloxy]benzyloxy}benzyloxy)benzoate self-assembles in a spherical dendrimer that self-organizes in a three-dimensional cubic Pm3̄n lattice. Structural analysis of these lattices by X-ray diffraction provided the first direct demonstration of the supramolecular dendrimer shape change from cylindrical to spherical and indirect determination of the average shape change of the monodendron from a quarter of a disk to a half of a disk and to a sixth of a sphere as a function of generation number. These results have demonstrated the concept of monodendron and supramolecular dendrimer shape control by generation number.