Comparative analysis of molecular and biological characteristics of strains of Beauveria brongniartii isolated from insects

Neuvéglise, Cécile; Brygoo, Yves; Vercambre, Bernard; Riba, Guy

doi:10.1016/s0953-7562(09)80460-7

Cited by 84 publications

(60 citation statements)

References 10 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Faris-Mokaiesh et al [18] also confirmed the identity of two isolates MP-007 Fra and MP-014 Fra as A. pisi, erroneously identified as A. pinodes, in PCR-RFLP analysis of IGS region of rDNA. The true identity of pathogen isolates has also been confirmed with molecular methods in Beauvaria brongniartii [32]. Similarly, As44 (FJ032643) isolated from chickpea showed minimum genetic distance of 0.000-0.002 with A. rabiei sequences (EU595358, EU573020, DQ383949, and DQ822480) available at NCBI gene bank.…”

Section: Molecular Characterizationmentioning

confidence: 67%

Identification and Genetic Diversity Analysis of Ascochyta Species Associated with Blight Complex of Pea in a Northwestern Hill State of India

2012

View full text Add to dashboard Cite

Forty isolates of Ascochyta spp. infecting pea collected from different commercial pea growing areas of Himachal Pradesh were characterized into three species-Ascochyta pinodes, A. pisi and A. pinodella-based on symptoms, morphological and cultural traits. The identity of the isolates was confirmed by studying the rDNA sequence patterns. Based on various cultural and morphological trait combinations, 36 isolates were identified as A. pinodes, one isolate as A. pisi and one isolate as A. pinodella. Whereas two isolates, As3 and As14, could not be placed in any of the species as equal number of characters matched with A. pisi and A. pinodes. However, sequencing of ITS region of these isolates resolved the ambiguity and placed them in A. pinodes. This necessitates ITS sequencing as one of the criteria to establish the taxonomic status of Ascochyta species infecting pea. RAPD, RAMS, and Rep-PCR analysis with 10, 4 and universal ERIC, and BOX-AIR primers categorized different isolates according to their geographical locations. This study established the predominance of A. pinodes in Himachal Pradesh where edible pea is one of the remunerative offseason vegetable crops. This also constitutes first report of genetic variability of Ascochyta species infecting pea in India.

show abstract

Section: Molecular Characterizationmentioning

confidence: 67%

Identification and Genetic Diversity Analysis of Ascochyta Species Associated with Blight Complex of Pea in a Northwestern Hill State of India

2012

View full text Add to dashboard Cite

show abstract

“…The six distinct restriction enzymes tested in this study were able to clearly distinguish the different Metarhizium species investigated. Ribosomal genes and their ITS and IGS spacer regions have been widely used for the identification and differentiation of species (Fouly et al, 1997) as well as in taxonomic (Driver et al, 2000), phylogenetic (Rakotonirainy et al, 1994) and genetic diversity (Anderson et al, 2001;Uetake et al, 2002) studies, with ITS sequences having been reported as being useful for discriminating between different species of fungi (Neuveglise et al, 1994;Fouly et al, 1997;Jensen et al, 2001;Anderson et al, 2001;Thomsen and Jensen, 2002). 250 Destéfano et al Figure 4 -Amplification of DNA from pure cultures and infected larvae using the primer sets ITSMet/ITS4 (A) and ITS14/ITS4 (B).…”

Section: Discussionmentioning

confidence: 99%

Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

Destéfano

Messias

2004

Genet. Mol. Biol.

View full text Add to dashboard Cite

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S-ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E 9 , B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E 9 , B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.

show abstract

“…In the case of entomopathogenic fungi with a wide range of hosts such as Beauveria bassiana numerous studies have confirmed that strains of diverse geographical origin but isolated from the same host species showed a greater similarity in the genetic structure than strains from the same area but isolated from different host species (Poprawski et al, 1988;Neuvéglise et al, 1994;Cravanzola et al, 1997;Couteaudier & Viaud, 1997;Maurer et al, 1997;Castrillo & Brooks, 1998 Neuvéglise et al (1994) have shown the relationship between the genetic structure of Beauveria brongniartii strains and their biological origins (host species). The results of PCR-RFLP revealed a perfectly homogenous group of strains isolated from Hoplochelus marginalis.…”

Section: Intraspecific Variation Of Entomopathogenic Fungimentioning

confidence: 99%

Entomopathogenic Fungi as an Important Natural Regulator of Insect Outbreaks in Forests (Review)

Augustyniuk-Kram¹,

Kram²

2012

Forest Ecosystems - More Than Just Trees

View full text Add to dashboard Cite

The common idea for many people is that forests are just a collection of trees. However, they are much more than that. They are a complex, functional system of interacting and often interdependent biological, physical, and chemical components, the biological part of which has evolved to perpetuate itself. This complexity produces combinations of climate, soils, trees and plant species unique to each site, resulting in hundreds of different forest types around the world. Logically, trees are an important component for the research in forest ecosystems, but the wide variety of other life forms and abiotic components in most forests means that other elements, such as wildlife or soil nutrients, should also be the focal point in ecological studies and management plans to be carried out in forest ecosystems. In this book, the readers can find the latest research related to forest ecosystems but with a different twist. The research described here is not just on trees and is focused on the other components, structures and functions that are usually overshadowed by the focus on trees, but are equally important to maintain the diversity, function and services provided by forests. The first section of this book explores the structure and biodiversity of forest ecosystems, whereas the second section reviews the research done on ecosystem structure and functioning. The third and last section explores the issues related to forest management as an ecosystem-level activity, all of them from the perspective of the �other� parts of a forest.

show abstract

Comparative analysis of molecular and biological characteristics of strains of Beauveria brongniartii isolated from insects

Cited by 84 publications

References 10 publications

Identification and Genetic Diversity Analysis of Ascochyta Species Associated with Blight Complex of Pea in a Northwestern Hill State of India

Identification and Genetic Diversity Analysis of Ascochyta Species Associated with Blight Complex of Pea in a Northwestern Hill State of India

Detection of Metarhizium anisopliae var. anisopliae within infected sugarcane borer Diatraea saccharalis (Lepidoptera, Pyralidae) using specific primers

Entomopathogenic Fungi as an Important Natural Regulator of Insect Outbreaks in Forests (Review)

Contact Info

Product

Resources

About