The phylogenetic classification of the species Burkholderia andropogonis within the Burkholderia genus was reassessed using 16S rRNA gene phylogenetic analysis and multilocus sequence analysis (MLSA). Both phylogenetic trees revealed two main groups, named A and B, strongly supported by high bootstrap values (100%). Group A encompassed all of the Burkholderia species complex, whi.le Group B only comprised B. andropogonis species, with low percentage similarities with other species of the genus, from 92 to 95% for 16S rRNA gene sequences and 83% for conserved gene sequences. Average nucleotide identity (ANI), tetranucleotide signature frequency, and percentage of conserved proteins POCP analyses were also carried out, and in the three analyses B. andropogonis showed lower values when compared to the other Burkholderia species complex, near 71% for ANI, from 0.484 to 0.724 for tetranucleotide signature frequency, and around 50% for POCP, reinforcing the distance observed in the phylogenetic analyses. Our findings provide an important insight into the taxonomy of B. andropogonis. It is clear from the results that this bacterial species exhibits genotypic differences and represents a new genus described herein as Robbsia andropogonis gen. nov., comb. nov.

This PCR-based diagnostic test is suitable for monitoring asymptomatic plants in areas where the bacteria is endemic, in plant quarantine and regulatory situations, and also for obtaining an accurate diagnosis in a very short time. These are important characteristics for any assay to be used for the management of citrus canker disease.

Plant growth promoting rhizobacteria are well described and recommended for several crops worldwide. However, one of the most common problems in research into them is the difficulty in obtaining reproducible results. Furthermore, few studies have evaluated plant growth promotion and soil microbial community composition resulting from bacterial inoculation under field conditions. Here we evaluated the effect of 54 Pseudomonas strains on lettuce (Lactuca sativa) growth. The 12 most promising strains were phylogenetically and physiologically characterized for plant growth-promoting traits, including phosphate solubilization, hormone production and antagonism to pathogen compounds, and their effect on plant growth under farm field conditions. Additionally, the impact of beneficial strains on the rhizospheric bacterial community was evaluated for inoculated plants. The strains IAC-RBcr4 and IAC-RBru1, with different plant growth promoting traits, improved lettuce plant biomass yields up to 30%. These two strains also impacted rhizosphere bacterial groups including Isosphaera and Pirellula (phylum Planctomycetes) and Acidothermus, Pseudolabrys and Singusphaera (phylum Actinobacteria). This is the first study to demonstrate consistent results for the effects of Pseudomonas strains on lettuce growth promotion for seedlings and plants grown under tropical field conditions.

In order to construct specific primers for the detection and identification of the entomopathogenic fungus Metarhizium within infected sugarcane borer (Diatraea saccharalis) larvae we analyzed the ITS1 -5.8S-ITS2 rDNA regions of strains and varieties of M. anisopliae, M. album and M. flavoviride. The PCR amplification of these regions yielded a unique fragment of approximately 540 bp for M. anisopliae variety anisopliae strains E 9 , B/Vi and C (isolated in Brazil), 600 pb for M. a. anisopliae strain 14 (isolated in Australia), 650 bp for the M. album and 600 bp for M. flavoviride strains. The PCR products were digested with different restriction endonucleases (Afa I, Alu I, Dde I, Hae III, Hpa II and Sau 3A) and the PCR-RFLP profiles showed clear differences between the species. Sequencing of the ITS-5.8S rDNA regions allowed us to design one specific primer (ITSMet: 5' TCTGAATTTTTTATAAGTAT 3') for the Brazilian M. a. anisopliae strains (E 9 , B/Vi and C) and another specific primer (ITSMet14: 5' GAAACCGGGAC TAGGCGC 3') for the Australian strain (strain 14). Amplification was not observed with M. album, M flavoviride and Beauveria bassiana strains. DNA extracted from larvae infected with the Brazilian or Australian strains were tested using the specific primers designed by us to identify the fungal strains with which the larva had been infected. The correct fungal strain was successfully detected within 48 h of the insect having been infected, showing that this molecular technique allows rapid and secure detection and identification of M. anisopliae.

No abstract