Enhancement of immunogenicity and efficacy of a plasmid DNA rabies vaccine by nanoformulation with a fourth-generation amine-terminated poly(ether imine) dendrimer

Abstract

Purpose Delayed onset of, and low magnitude of, protective immune responses are major drawbacks limiting the practical utility of plasmid vaccination against rabies. In this study we evaluated whether nanoformulation with the novel poly(ether imine) (PETIM) dendrimer can enhance the immunogenicity and efficacy of a plasmid-based rabies vaccine. Materials and methods A plasmid vaccine construct (pIRES-Rgp) was prepared by cloning the full-length rabies virus glycoprotein gene into pIRES vector. Drawing upon the results of our previous study, a dendriplex (dendrimer-DNA complex) of pIRES-Rgp was made with PETIM dendrimer (10:1 w/w, PETIM:pIRES-Rgp). In vitro transfection was done on baby hamster kidney (BHK)-21 cells to evaluate expression of glycoprotein gene from pIRES-Rgp and PETIM-pIRES-Rgp. Subsequently, groups of Swiss albino mice were immunized intramuscularly with pIRES-Rgp or PETIM-pIRES-Rgp. A commercially available cell culture rabies vaccine was included for comparison. Rabies virus neutralizing antibody (RVNA) titers in the immune sera were evaluated on days 14, 28, and 90 by rapid fluorescent focus inhibition test. Finally, an intracerebral challenge study using a challenge virus standard strain of rabies virus was done to evaluate the protective efficacy of the formulations. Results Protective levels of RVNA titer (≥0.5 IU/mL) were observed by day 14 in animals immunized with pIRES-Rgp and its dendriplex. Notably, PETIM-pIRES-Rgp produced 4.5-fold higher RVNA titers compared to pIRES-Rgp at this time point. All mice immunized with the PETIM-pIRES-Rgp survived the intracerebral rabies virus challenge, compared with 60% in the group which received pIRES-Rgp. Conclusion Our results suggest that nanoformulation with PETIM dendrimer can produce an earlier onset of a high-titered protective antibody response to a plasmid-based rabies vaccine. PETIM dendriplexing appears to be an efficacious nonviral delivery strategy to enhance genetic vaccination.

Nanoneuromedicines for degenerative, inflammatory, and infectious nervous system diseases

“…A dendrimer-DNA complex (dendriplex) using a plasmid vaccine construct of the rabies virus glycoprotein gene was complexed with a novel poly(ether imine) (PETIM) dendrimer and used to immunize mice that were subsequently challenged with a standard rabies virus strain. 90 These mice demonstrated 4-fold improved viral titers 14 days after immunization compared to mice immunized with the unformulated plasmid viral construct. In addition, all mice receiving the dendriplex vaccine compared with 60% of the mice receiving the unformulated vaccine survived viral challenge.…”

Immunogenicity and efficacy of a plasmid DNA rabies vaccine incorporating Myd88 as a genetic adjuvant

“…pFLAG-CMV4-hMyd88, containing an 891 bp fragment of human myeloid differentiation factor primary response gene was a kind gift from Dr. Fumihiko Takeshita, Yokohama City University School of Medicine, Japan. The development of pIRES-Rgp encoding the glycoprotein gene of rabies virus has been reported by us earlier [ 8 ]. Large-scale, endotoxin-free plasmid preparations were made using a commercial kit (EndoFree Plasmid Purification Giga Kit, Qiagen, Hilden, Germany).…”

“…The full-length glycoprotein gene (G) was PCR amplified from pBacPak-GRC9 vector using the primers GFor (ATTAGCTAGCATGGTTCCTCAGGCTCTCC) and GRev (ATGTAGAATTCTCACAGTCTGGTCTGAC) bearing Nhe I and Mlu I sites, respectively, and subcloned between these restriction sites in the multiple cloning site-A of pIRES vector, as reported earlier [ 8 ]. The construct was named pIRES-Rgp.…”

“…In general, systemic lability, poor cellular uptake and low immunogenicity remain major hurdles limiting the utility of plasmids for in vivo applications [ 6 ]. Attempts to improve plasmid-based vaccination are currently focused on improved vector design, gene modifications and the use of efficient delivery vehicles and molecular adjuvants [ 7 , 8 ].…”

Dendrimer-based nanoparticles in cancer chemotherapy and gene therapy

“…Dendrimers are a category of synthetic macromolecules with highly branched, monodispersed and well-defined tree-like architecture. The commonly used dendrimers include poly(amidoamine) (PAMAM) [15,16], poly(prophylenimine) (PPI), poly(L-lysine) (PLL) [17], triazine dendrimer [18,19], poly(ether imine) (PETIM) [20][21][22], carbosilane dendrimer [23], viologen dendrimer [24], and phosphorus dendrimer [25][26][27]. The functional nanoparticles (NPs) can be constructed based on the unique features of dendrimers for delivery of therapeutic agents [28][29][30][31][32][33][34][35].…”